ID: 1059344037

View in Genome Browser
Species Human (GRCh38)
Location 9:113616270-113616292
Sequence CAGGCTCCAGGCTCTGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059344024_1059344037 18 Left 1059344024 9:113616229-113616251 CCAGCACTATCAGCAGCCAGCAG No data
Right 1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG No data
1059344023_1059344037 19 Left 1059344023 9:113616228-113616250 CCCAGCACTATCAGCAGCCAGCA No data
Right 1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG No data
1059344028_1059344037 2 Left 1059344028 9:113616245-113616267 CCAGCAGTGTGGCGACCCGGGCA No data
Right 1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG No data
1059344022_1059344037 28 Left 1059344022 9:113616219-113616241 CCACATTCACCCAGCACTATCAG No data
Right 1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG No data
1059344021_1059344037 29 Left 1059344021 9:113616218-113616240 CCCACATTCACCCAGCACTATCA No data
Right 1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059344037 Original CRISPR CAGGCTCCAGGCTCTGGAGG AGG Intergenic
No off target data available for this crispr