ID: 1059344201

View in Genome Browser
Species Human (GRCh38)
Location 9:113617025-113617047
Sequence CCCTGGGGCCCTTCACCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059344201_1059344212 30 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344212 9:113617078-113617100 TCCGTAGTTGCCTCAGACCAGGG No data
1059344201_1059344211 29 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344211 9:113617077-113617099 GTCCGTAGTTGCCTCAGACCAGG No data
1059344201_1059344210 4 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344210 9:113617052-113617074 CACTTGGAGGTAAACGGAGGTGG No data
1059344201_1059344208 -2 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344208 9:113617046-113617068 GGCAGACACTTGGAGGTAAACGG No data
1059344201_1059344204 -9 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344204 9:113617039-113617061 GCCCCAGGGCAGACACTTGGAGG No data
1059344201_1059344209 1 Left 1059344201 9:113617025-113617047 CCACAAGGTGAAGGGCCCCAGGG No data
Right 1059344209 9:113617049-113617071 AGACACTTGGAGGTAAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059344201 Original CRISPR CCCTGGGGCCCTTCACCTTG TGG (reversed) Intergenic
No off target data available for this crispr