ID: 1059344331

View in Genome Browser
Species Human (GRCh38)
Location 9:113617816-113617838
Sequence TATCCTACTCCCAGGGGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059344325_1059344331 8 Left 1059344325 9:113617785-113617807 CCTGGGGCGTATCAGATACTCCT No data
Right 1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG No data
1059344324_1059344331 9 Left 1059344324 9:113617784-113617806 CCCTGGGGCGTATCAGATACTCC No data
Right 1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059344331 Original CRISPR TATCCTACTCCCAGGGGTTG TGG Intergenic
No off target data available for this crispr