ID: 1059348245

View in Genome Browser
Species Human (GRCh38)
Location 9:113646795-113646817
Sequence CAGATCACGCAGGGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059348245_1059348248 -5 Left 1059348245 9:113646795-113646817 CCTTCAAGGCCCTGCGTGATCTG No data
Right 1059348248 9:113646813-113646835 ATCTGACTCCCGTTCACCTCCGG No data
1059348245_1059348249 -4 Left 1059348245 9:113646795-113646817 CCTTCAAGGCCCTGCGTGATCTG No data
Right 1059348249 9:113646814-113646836 TCTGACTCCCGTTCACCTCCGGG No data
1059348245_1059348254 21 Left 1059348245 9:113646795-113646817 CCTTCAAGGCCCTGCGTGATCTG No data
Right 1059348254 9:113646839-113646861 CTCATTTTCTCTCTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059348245 Original CRISPR CAGATCACGCAGGGCCTTGA AGG (reversed) Intergenic
No off target data available for this crispr