ID: 1059353535

View in Genome Browser
Species Human (GRCh38)
Location 9:113682940-113682962
Sequence CACTGGGAAGGGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059353524_1059353535 -4 Left 1059353524 9:113682921-113682943 CCGTGTCTTTTCTCTACCACACT No data
Right 1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG No data
1059353523_1059353535 17 Left 1059353523 9:113682900-113682922 CCTGCAGTGGGCAGGCAGGGACC No data
Right 1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059353535 Original CRISPR CACTGGGAAGGGAGGGAAGG GGG Intergenic
No off target data available for this crispr