ID: 1059361776

View in Genome Browser
Species Human (GRCh38)
Location 9:113748807-113748829
Sequence GGGTCCACATGGTTTAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059361776_1059361781 -6 Left 1059361776 9:113748807-113748829 CCCCTCTTAAACCATGTGGACCC No data
Right 1059361781 9:113748824-113748846 GGACCCAGTAGTTTTATGGTTGG No data
1059361776_1059361780 -10 Left 1059361776 9:113748807-113748829 CCCCTCTTAAACCATGTGGACCC No data
Right 1059361780 9:113748820-113748842 ATGTGGACCCAGTAGTTTTATGG No data
1059361776_1059361784 24 Left 1059361776 9:113748807-113748829 CCCCTCTTAAACCATGTGGACCC No data
Right 1059361784 9:113748854-113748876 TTCCATAACTTTCTCTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059361776 Original CRISPR GGGTCCACATGGTTTAAGAG GGG (reversed) Intergenic
No off target data available for this crispr