ID: 1059363672

View in Genome Browser
Species Human (GRCh38)
Location 9:113768395-113768417
Sequence TGCCAGGGTAACCACAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059363666_1059363672 25 Left 1059363666 9:113768347-113768369 CCATGATCACTGCCAAAATAGAG No data
Right 1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG No data
1059363669_1059363672 0 Left 1059363669 9:113768372-113768394 CCAAGAATGCTATGTGAGGTCTG No data
Right 1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG No data
1059363667_1059363672 13 Left 1059363667 9:113768359-113768381 CCAAAATAGAGATCCAAGAATGC No data
Right 1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059363672 Original CRISPR TGCCAGGGTAACCACAGTCA AGG Intergenic
No off target data available for this crispr