ID: 1059367781

View in Genome Browser
Species Human (GRCh38)
Location 9:113800177-113800199
Sequence CAGAAAACAGCAGCTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059367774_1059367781 2 Left 1059367774 9:113800152-113800174 CCTGCCACTTCTAAGACCCTATC No data
Right 1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG No data
1059367773_1059367781 8 Left 1059367773 9:113800146-113800168 CCAAGTCCTGCCACTTCTAAGAC No data
Right 1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG No data
1059367775_1059367781 -2 Left 1059367775 9:113800156-113800178 CCACTTCTAAGACCCTATCCTCA No data
Right 1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG No data
1059367772_1059367781 28 Left 1059367772 9:113800126-113800148 CCACTGGCAACTATGCATTTCCA No data
Right 1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059367781 Original CRISPR CAGAAAACAGCAGCTGTGGA GGG Intergenic
No off target data available for this crispr