ID: 1059370032

View in Genome Browser
Species Human (GRCh38)
Location 9:113822763-113822785
Sequence CCTGAAAACCAGAGAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059370032_1059370036 6 Left 1059370032 9:113822763-113822785 CCATTCACTCTCTGGTTTTCAGG No data
Right 1059370036 9:113822792-113822814 ACTACACCATTGGTTTTCCTGGG No data
1059370032_1059370035 5 Left 1059370032 9:113822763-113822785 CCATTCACTCTCTGGTTTTCAGG No data
Right 1059370035 9:113822791-113822813 AACTACACCATTGGTTTTCCTGG No data
1059370032_1059370034 -4 Left 1059370032 9:113822763-113822785 CCATTCACTCTCTGGTTTTCAGG No data
Right 1059370034 9:113822782-113822804 CAGGCTTTCAACTACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059370032 Original CRISPR CCTGAAAACCAGAGAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr