ID: 1059373022

View in Genome Browser
Species Human (GRCh38)
Location 9:113858613-113858635
Sequence CAGGCACCTGCACTTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059373022_1059373028 9 Left 1059373022 9:113858613-113858635 CCATTACCAAGTGCAGGTGCCTG No data
Right 1059373028 9:113858645-113858667 GCTGGAGGTTGAGAGACATGTGG No data
1059373022_1059373025 -6 Left 1059373022 9:113858613-113858635 CCATTACCAAGTGCAGGTGCCTG No data
Right 1059373025 9:113858630-113858652 TGCCTGTGCTAGCCTGCTGGAGG No data
1059373022_1059373029 24 Left 1059373022 9:113858613-113858635 CCATTACCAAGTGCAGGTGCCTG No data
Right 1059373029 9:113858660-113858682 ACATGTGGACCAGAATCAAGTGG No data
1059373022_1059373024 -9 Left 1059373022 9:113858613-113858635 CCATTACCAAGTGCAGGTGCCTG No data
Right 1059373024 9:113858627-113858649 AGGTGCCTGTGCTAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059373022 Original CRISPR CAGGCACCTGCACTTGGTAA TGG (reversed) Intergenic
No off target data available for this crispr