ID: 1059373330

View in Genome Browser
Species Human (GRCh38)
Location 9:113861649-113861671
Sequence CAGAGAACTCAGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059373330_1059373342 29 Left 1059373330 9:113861649-113861671 CCATCCTCCTGCTGAGTTCTCTG No data
Right 1059373342 9:113861701-113861723 TCCTTCTCCCCAGTAGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059373330 Original CRISPR CAGAGAACTCAGCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr