ID: 1059375556

View in Genome Browser
Species Human (GRCh38)
Location 9:113878158-113878180
Sequence CAAACCCCCCAAAATGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059375556 Original CRISPR CAAACCCCCCAAAATGATCA AGG (reversed) Intronic
901495907 1:9621726-9621748 CCATGCCCCCAGAATGATCAAGG - Intergenic
905782737 1:40727103-40727125 CAAACCCCTCAAAATCATCCAGG + Intronic
906325113 1:44840731-44840753 CAAAAACCCAAAAATTATCAGGG + Intronic
906630604 1:47364072-47364094 CAAACACCCCAAAATGCTGCAGG - Intronic
907475542 1:54702941-54702963 CATACCTCCCACGATGATCACGG + Intronic
910445294 1:87293959-87293981 CAAACCCCAACAAATGTTCAAGG + Intergenic
912486280 1:110031420-110031442 CAAACCCACCAAAATCAATATGG - Intergenic
912597785 1:110896623-110896645 CCAAACCCCCAAAATGATGATGG - Intronic
913526994 1:119703024-119703046 CAAAGCCCTCAAAATCATCTTGG + Intronic
914442078 1:147716602-147716624 CAAACCCACCAAAATCAAAAGGG - Intergenic
914865002 1:151419506-151419528 AAAACCCCCCAAAATTAGCTGGG + Intronic
919054701 1:192555030-192555052 CAAAACCCTAAAAATGATTAAGG - Intergenic
922302174 1:224311216-224311238 AAAACCCCCCAAAATTAGCCAGG - Intronic
1066144161 10:32539220-32539242 CAACCACCCAAAAATGATCCAGG - Intronic
1069661493 10:70126501-70126523 CAGACCCGCAAAGATGATCAGGG - Intronic
1071014040 10:80973606-80973628 AAAAACCCCCAAAATTATAAGGG + Intergenic
1071398436 10:85245734-85245756 AAAACCCCCCAAAAAGGTTATGG - Intergenic
1072323930 10:94277489-94277511 CAAGGCCCCCAAGATGCTCAAGG - Intronic
1075950364 10:126472329-126472351 GACACTCCCCAAAATGCTCACGG + Intronic
1077518813 11:3018975-3018997 GAAACCACACTAAATGATCAGGG + Intronic
1078657597 11:13256182-13256204 CAAACTCCCCAGGATGTTCAGGG - Intergenic
1079471761 11:20785278-20785300 ACACCCCCACAAAATGATCAGGG - Intronic
1080075267 11:28140555-28140577 ACAAGCCCCCAAAATGATGAAGG + Intronic
1080742598 11:35080202-35080224 CACACCCCCTAAAATCATCTTGG - Intergenic
1083177862 11:60963657-60963679 CAAACCCCACAAAATTATTGGGG - Intergenic
1085505740 11:77057860-77057882 CTTACACCCCAAAATGAACAAGG + Intergenic
1085590175 11:77752887-77752909 CAAACCCCCCAAAACCAGGATGG + Intronic
1086161459 11:83726585-83726607 CAAATCCCCCCAAAAGATAAGGG + Intronic
1087905913 11:103697350-103697372 CATTCCCCCCAAAATGCACAAGG + Intergenic
1088166149 11:106939921-106939943 CAAACCCCACAATATGGTGAGGG + Exonic
1088769931 11:113024043-113024065 GGAACCCTCCAAAGTGATCAAGG - Intronic
1089198823 11:116711155-116711177 CCAGCCCCCCAAGATAATCAGGG + Intergenic
1090024682 11:123157556-123157578 CAAAACCCCCAAAATTAGCTGGG + Intronic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1097940708 12:65302192-65302214 TACACTCCCCAAAATTATCAAGG - Intronic
1098044082 12:66382076-66382098 CAAACCCCTCAAAATTAGCTGGG + Intronic
1099453098 12:82831549-82831571 GAAACCTCCCAAAACAATCATGG - Intronic
1099811436 12:87587444-87587466 CAGACCCCCCTAAATAATCCAGG + Intergenic
1105351954 13:19623868-19623890 CCCACACCCCAAAATGAACATGG - Intergenic
1110640200 13:77814858-77814880 CAAACCCCTCAAAGTCATCCAGG - Intergenic
1114946687 14:27690445-27690467 AAAACCCACCAAAATGAAGATGG - Intergenic
1115732622 14:36287740-36287762 CAAATCCCCCAAATTTAGCATGG - Intergenic
1115862637 14:37705794-37705816 CAAACCTCCCCAAATAATCAGGG - Intronic
1116332568 14:43614232-43614254 CAAAGCCTCCAGAATGATAATGG + Intergenic
1116593518 14:46810531-46810553 CAAACCACTGAACATGATCAGGG - Intergenic
1117625303 14:57630699-57630721 CACACGCCTAAAAATGATCATGG - Intronic
1118011358 14:61613799-61613821 CAAACCCACCCATATTATCAAGG + Intronic
1120805173 14:88739411-88739433 CAATCCCCCCCAAAATATCAAGG + Intronic
1122440363 14:101727499-101727521 CAAACCCCTCAAAATGAGCCTGG + Intergenic
1122758249 14:103999699-103999721 TACACCCCCCAAAATAATAAAGG + Intronic
1123134445 14:106014042-106014064 AAAACCTCCCAAAATTGTCATGG + Intergenic
1123584479 15:21744482-21744504 AAAACCTCCCAAAATTGTCATGG + Intergenic
1123621123 15:22187093-22187115 AAAACCTCCCAAAATTGTCATGG + Intergenic
1124824884 15:33083978-33084000 CAAACTTCCCAACATGACCATGG - Intronic
1125270768 15:37936284-37936306 CTCAGCCCCCAAAATGAACAAGG - Intronic
1125283070 15:38063787-38063809 CAAACCCACCTAAATGGACAAGG - Intergenic
1136135659 16:28255495-28255517 CAGACCCTCCAAGATGTTCAGGG + Intergenic
1138615723 16:58164314-58164336 CAAACACTGAAAAATGATCAGGG + Intronic
1141403423 16:83770778-83770800 AAAACCCACCAAAATCAACATGG - Intronic
1146023342 17:29297851-29297873 AAAACACCCCAAAATCATCCAGG - Intergenic
1147112979 17:38277514-38277536 CCAACCCCCCAGAATGATCCAGG + Intergenic
1147301691 17:39534076-39534098 CAAAACCACAAAAATGATCACGG - Exonic
1148416643 17:47511713-47511735 CCAACCCCCCAGACTGATCCAGG - Intergenic
1150610655 17:66730676-66730698 AAAACCCGCCAAAATCAACAAGG - Intronic
1150658778 17:67057762-67057784 AAAAACCCCCAAAACAATCAAGG + Intergenic
1151026402 17:70682672-70682694 CAATCTCACCACAATGATCAAGG - Intergenic
1151384613 17:73747497-73747519 CAGAGCCCCCAGAATGCTCAGGG + Intergenic
1152390178 17:79999453-79999475 AAAACCAACCAAAATGATAACGG + Intronic
1153909104 18:9690701-9690723 CAAAACCCACAAAATTAGCAGGG - Intergenic
1157811311 18:50698245-50698267 CAAACAGCCCTAAATTATCAAGG + Intronic
1159124999 18:64212731-64212753 CAAACAGCCCAAAGTGAACAGGG - Intergenic
1159240145 18:65731897-65731919 CAACCCCCTCAAATTCATCATGG - Intergenic
1161420669 19:4174637-4174659 CAGACCCCCCAAAAGGGTGAAGG - Exonic
1162839907 19:13348845-13348867 AAAACCCCCCAAAATTAGCTGGG + Intronic
1164000198 19:21091301-21091323 AAAACCCACCAAAATTAACATGG - Intronic
1164006358 19:21153187-21153209 AAAACCCACCAAAATTAACATGG - Intronic
1167316506 19:48766386-48766408 AAAACCCCCCAAAATTAACGAGG - Intergenic
1168476770 19:56681639-56681661 CAAACCCACGAAAATCAACAAGG - Intergenic
927514842 2:23666192-23666214 CAAAGCCTCCCAAATGATGACGG + Intronic
929858763 2:45657525-45657547 TATAGCCCCCAAAATGAGCATGG + Intronic
933427332 2:82129657-82129679 CAAACCCACCAAAACCAACATGG + Intergenic
936417918 2:112336257-112336279 CCAACCCTCCAAAAACATCAGGG - Exonic
936863829 2:117055187-117055209 CATAGCCCTGAAAATGATCAAGG - Intergenic
937146906 2:119655247-119655269 CATTCCCCACAAAATGTTCAAGG + Intronic
938821024 2:134960328-134960350 AAAACCCCCCAAAATTAGCCGGG - Intergenic
941925198 2:170887396-170887418 CAAACATCACAAAATGATTAGGG - Intergenic
942237701 2:173928212-173928234 CAAACCCTTCAAAATGAAGATGG + Intronic
942594052 2:177575446-177575468 CACACACCCGAAAGTGATCATGG - Intergenic
943623120 2:190171356-190171378 ACAACCCCTTAAAATGATCATGG + Intronic
943637105 2:190318548-190318570 CAAAGCCCCCAAAATGGTCCTGG + Intronic
944303130 2:198147316-198147338 CAATTGTCCCAAAATGATCAAGG - Exonic
945828255 2:214750830-214750852 CAAATCCCCCAAACTGAGGATGG + Intronic
946462197 2:219878613-219878635 CAAACCCCCCAAAACCAAGATGG + Intergenic
947448505 2:230183318-230183340 CAAAGACCCAAAAATGATTAAGG - Intronic
947947234 2:234115917-234115939 GTAACCCCCCAAAATGCTGAAGG + Intergenic
1171216452 20:23356129-23356151 CACACACCCCAAATTGATAATGG - Intergenic
1171290741 20:23981630-23981652 CCAACCCCCCAGGGTGATCAAGG + Intergenic
1173517582 20:43675741-43675763 CAAAGCCCCCAAAAAGAAAAAGG - Intronic
1174935923 20:54868490-54868512 GATACTCCCCAAAACGATCAAGG - Intergenic
1178271919 21:31198572-31198594 CTAACACCACAAAATGCTCAAGG + Intronic
1179368210 21:40779171-40779193 AAAATACACCAAAATGATCAAGG - Intronic
1179495833 21:41770837-41770859 CAAACCCCCAAAACTTAACATGG + Intergenic
1182538416 22:31023615-31023637 CAAACCCACCAAAATTAAGACGG - Intergenic
1184317799 22:43710788-43710810 CACTCCCCACAAAATGAACATGG + Intronic
952388099 3:32857465-32857487 CTAACCCCCCACATTGTTCAAGG - Intronic
953579640 3:44142166-44142188 AATGCCCCCCAAAGTGATCAAGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955150871 3:56366042-56366064 CAATCTGCCCAGAATGATCAGGG + Intronic
956209946 3:66792229-66792251 CAATCCCCTCAAAATGCTCTTGG - Intergenic
956403997 3:68909171-68909193 CAAACCCCCCAAAAAAAAAAGGG + Intronic
957296340 3:78337606-78337628 CAAACCCCCCATAGAGTTCATGG + Intergenic
960598072 3:119425069-119425091 CAAACACCCCCAAATGGCCAAGG - Intergenic
960929442 3:122830201-122830223 TAAACCTCCCAACATGAACATGG - Intronic
965066516 3:163857149-163857171 CACACCCCCTATAATGTTCAGGG - Intergenic
965815693 3:172634429-172634451 CAAAACCCCCAAAAAGGTCATGG + Intronic
966171997 3:177092259-177092281 CCAACCTCCCAAAATAATAAAGG + Intronic
966569887 3:181429810-181429832 CAAACCCCCCATAAATACCAAGG + Intergenic
967902137 3:194465444-194465466 AGAACCACCCAAAATGATTAAGG + Intronic
968155626 3:196378769-196378791 AAAACCCCCCAAAACCAACATGG - Intronic
968155646 3:196378877-196378899 AAAACCCCCCAAAACCAACATGG - Intronic
968155654 3:196378913-196378935 AAAACCCCCCAAAACCAACATGG - Intronic
968155662 3:196378949-196378971 AAAACCCCCCAAAACCAACATGG - Intronic
968155684 3:196379057-196379079 AAAACCCCCCAAAACCAACATGG - Intronic
968155699 3:196379131-196379153 AAAACCCCCCAAAACCAACATGG - Intronic
968155707 3:196379167-196379189 AAAACCCCCCAAAACCAACATGG - Intronic
968155715 3:196379203-196379225 AAAACCCCCCAAAACCAACATGG - Intronic
970994116 4:22246165-22246187 CAAACCCCAGAAAAGGGTCATGG + Intergenic
972182527 4:36486622-36486644 CAAACCCCCAAAGATGTTTAAGG + Intergenic
980643182 4:135605366-135605388 AAAACCCACCAAAATGAAGATGG - Intergenic
981205176 4:142032435-142032457 AGAACCCCCCAAGATGATCTTGG + Intronic
981296384 4:143137532-143137554 CATACCCCCAAAAATGATGTAGG + Intergenic
981851087 4:149231003-149231025 CAAACCCTTCAAAAAAATCAAGG + Intergenic
983878576 4:172906252-172906274 CAAATACCCAAAAATGATAATGG + Intronic
984211621 4:176856545-176856567 CAAGGGCCCCAAAATGGTCAAGG - Intergenic
986377176 5:7144193-7144215 CGAACCTTCCAAAATGAACAGGG + Intergenic
986821702 5:11474305-11474327 CAACTCTCCCAAAATGAGCAAGG + Intronic
987454169 5:18122524-18122546 AAAACCCTCCAAAAAAATCAAGG + Intergenic
989741937 5:44783945-44783967 CAAACCCACCAAAATCAACATGG - Intergenic
990467769 5:56086163-56086185 AAAACCCCCCAAAATTAGCCAGG + Intergenic
991545264 5:67774831-67774853 AAAACCCCACAAAGTTATCATGG + Intergenic
992088594 5:73299044-73299066 CAAACCCCCCGAAATCCTCGAGG - Intergenic
992859148 5:80893945-80893967 CAAAGCCTCCAAAGTGATAACGG - Intergenic
994537388 5:101049000-101049022 CAAACCCCCCAAATTGCAAATGG + Intergenic
999038979 5:148385601-148385623 AAAACCCCCCAACAGGATGATGG - Intronic
999395422 5:151223916-151223938 CAAACCCCCGAAAAAGGTAAAGG - Exonic
1001990938 5:176114716-176114738 CAAACCCTCCCAAGTGAGCATGG - Exonic
1002225935 5:177723424-177723446 CAAACCCTCCCAAGTGAGCATGG + Exonic
1002267911 5:178047786-178047808 CAAACCCTCCCAAGTGAGCATGG - Intronic
1006417532 6:33913473-33913495 CAAAATCCCCAAAATGCTCGGGG - Intergenic
1007388461 6:41535586-41535608 CAAACCCATCAAAATGGCCAAGG - Intergenic
1008463520 6:51804072-51804094 GATACCCACCAAAATGATCATGG + Intronic
1009717150 6:67412467-67412489 GAAACTCTCCAAAATGAGCATGG + Intergenic
1010442654 6:75915427-75915449 TAAACCACTTAAAATGATCAAGG + Exonic
1010787855 6:80025814-80025836 CAAACCCCAAACAATGATGAAGG - Intronic
1011042747 6:83048509-83048531 CAAAACCCCCTACATGATCAGGG + Intronic
1013686604 6:112592152-112592174 AACACCTCCCAAAATAATCATGG + Intergenic
1014686891 6:124512799-124512821 CAAACCCAGAAAAATTATCAGGG - Intronic
1015093475 6:129386855-129386877 CAAGCTCCCCAAAATGGACATGG - Intronic
1015472898 6:133626392-133626414 CAAGCTCCCCAAAATGGACATGG + Intergenic
1016116970 6:140299067-140299089 CAAAACCCCAAAAAACATCAAGG - Intergenic
1018123684 6:160661244-160661266 CACACCCCTCAAAGTGGTCAAGG - Intronic
1018127953 6:160700157-160700179 CCAACCCCTGAAATTGATCAAGG + Intergenic
1018148482 6:160916237-160916259 CCAACCCCCGAAATTGATCAAGG - Intergenic
1019083017 6:169448885-169448907 CAAAGCCACCAACATTATCACGG + Intergenic
1019760368 7:2807986-2808008 GGAAGCGCCCAAAATGATCACGG - Intronic
1020582652 7:10024261-10024283 CAGACATTCCAAAATGATCATGG - Intergenic
1020976850 7:15017164-15017186 CAAATCCATCAAAATCATCAGGG - Intergenic
1021632286 7:22659222-22659244 CCACCCCCCCAAAAAAATCAAGG + Intergenic
1021688732 7:23212116-23212138 AGGACCCCCCAAACTGATCAGGG + Intergenic
1027646445 7:80806816-80806838 CAATCCTGCCAAAATGACCACGG - Intronic
1029434436 7:100554422-100554444 CAAACCCCCAAACATAATCCTGG - Intronic
1029591791 7:101511830-101511852 AAAACCCCCCAAAATTAGCTGGG + Intronic
1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG + Intergenic
1032098161 7:128950079-128950101 TAAACCCCCATAAATGTTCAAGG + Intergenic
1032595527 7:133235815-133235837 GAAACCCCACAAAATGATATGGG - Intergenic
1032827787 7:135589203-135589225 GAAATCCCCCAAAATGAACATGG - Intronic
1033271726 7:139938263-139938285 CAAAGCCCCCCAAGTGATCCCGG - Intronic
1034451729 7:151140818-151140840 CTAAGCCCCACAAATGATCATGG + Intronic
1035381249 7:158442641-158442663 CTAAAGCCCCAAAATAATCATGG - Intronic
1039333565 8:36565592-36565614 CAAACCCACCTAATTTATCAAGG + Intergenic
1042869024 8:73380662-73380684 CAAACCCCCCAAAAGCATTTGGG + Intergenic
1043958426 8:86389624-86389646 CAAAACCCCCATCATCATCATGG + Intronic
1045539838 8:103073436-103073458 CAAAAACTCTAAAATGATCAAGG + Intergenic
1047978210 8:130152921-130152943 CAACCCCCCCAAAAAAATCCTGG + Intronic
1050688123 9:8194874-8194896 AAAATCCACCAAAATGATCCTGG + Intergenic
1051287059 9:15508623-15508645 CAAACACCTCAAAATAAACAAGG + Intronic
1052733796 9:32319450-32319472 CATAACCCTCAAAATGATCCTGG - Intergenic
1053620808 9:39813615-39813637 GAAACCCCCCAAAGTAATCTAGG - Intergenic
1054263355 9:62893827-62893849 GAAACCCCCCAAAGTAATCTAGG + Intergenic
1057749664 9:97781760-97781782 CAAACCCCACAAAATGATTTGGG - Intergenic
1059375556 9:113878158-113878180 CAAACCCCCCAAAATGATCAAGG - Intronic
1061281407 9:129599619-129599641 CAAACCCCCCAAAACCAAGATGG - Intergenic
1061482739 9:130905144-130905166 CCTGCCCTCCAAAATGATCAAGG - Intronic
1189379231 X:40489949-40489971 CACACCCCCAAAAATGTCCAGGG - Intergenic
1192080951 X:68047391-68047413 CAAACTCCCCAAAATCTACATGG + Intronic
1194819791 X:98491382-98491404 CAAACCCCCAAAAGGGGTCATGG + Intergenic
1196785297 X:119416582-119416604 CAAATGCCCGAAAATAATCAAGG - Intronic
1196903647 X:120410873-120410895 CACACCCCCTATAATGTTCAGGG + Intergenic
1201019700 Y:9642928-9642950 CCCACCCCCCAAAAAAATCAAGG - Intergenic
1201462849 Y:14246515-14246537 TATACCCCCCATAAAGATCATGG - Intergenic