ID: 1059377697

View in Genome Browser
Species Human (GRCh38)
Location 9:113898753-113898775
Sequence GATCAGCGATGCAGCAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059377695_1059377697 18 Left 1059377695 9:113898712-113898734 CCTTGAGTGGAAAGAGGAGGGCT 0: 1
1: 0
2: 3
3: 14
4: 226
Right 1059377697 9:113898753-113898775 GATCAGCGATGCAGCAGCCCGGG No data
1059377691_1059377697 25 Left 1059377691 9:113898705-113898727 CCTCAAACCTTGAGTGGAAAGAG 0: 1
1: 0
2: 1
3: 18
4: 194
Right 1059377697 9:113898753-113898775 GATCAGCGATGCAGCAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059377697 Original CRISPR GATCAGCGATGCAGCAGCCC GGG Intronic
No off target data available for this crispr