ID: 1059379252

View in Genome Browser
Species Human (GRCh38)
Location 9:113910339-113910361
Sequence CAGAGTGAAGAGCAGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 433}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059379252_1059379256 21 Left 1059379252 9:113910339-113910361 CCTGGTTCCTGCTCTTCACTCTG 0: 1
1: 0
2: 2
3: 29
4: 433
Right 1059379256 9:113910383-113910405 TCCACTTAGCTCGAGCCAGCTGG No data
1059379252_1059379260 26 Left 1059379252 9:113910339-113910361 CCTGGTTCCTGCTCTTCACTCTG 0: 1
1: 0
2: 2
3: 29
4: 433
Right 1059379260 9:113910388-113910410 TTAGCTCGAGCCAGCTGGGGTGG No data
1059379252_1059379258 22 Left 1059379252 9:113910339-113910361 CCTGGTTCCTGCTCTTCACTCTG 0: 1
1: 0
2: 2
3: 29
4: 433
Right 1059379258 9:113910384-113910406 CCACTTAGCTCGAGCCAGCTGGG No data
1059379252_1059379259 23 Left 1059379252 9:113910339-113910361 CCTGGTTCCTGCTCTTCACTCTG 0: 1
1: 0
2: 2
3: 29
4: 433
Right 1059379259 9:113910385-113910407 CACTTAGCTCGAGCCAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059379252 Original CRISPR CAGAGTGAAGAGCAGGAACC AGG (reversed) Intronic
900337198 1:2170090-2170112 CAGGGTGAAGAGCAGAACCAGGG - Intronic
901871988 1:12143525-12143547 AAGCGTGCAGAGCCGGAACCAGG - Exonic
902063691 1:13666301-13666323 CATAATGAAGAGCAGGAATGGGG + Intergenic
902722757 1:18315034-18315056 CAGAGGGGAGAGCAGGGACAAGG + Intronic
902804998 1:18855486-18855508 CATAGAGAAGAGAAGGAACCAGG - Intronic
903674827 1:25056902-25056924 CAGTGTGAAGGGCAGGCACTTGG - Intergenic
903714700 1:25356277-25356299 AAGAGGGAAGAGCAGGGACAGGG - Intronic
903742804 1:25567998-25568020 TAGAGTGAAGAGTAGAACCCAGG + Exonic
903948812 1:26981719-26981741 CTGAAAGATGAGCAGGAACCAGG - Intergenic
904024018 1:27490712-27490734 CAGAGTGAAGTGGCTGAACCAGG - Intergenic
904471973 1:30741682-30741704 CATGGTGATGAGCAGGAAGCTGG + Exonic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906302712 1:44695175-44695197 CACAGTGAACTGCTGGAACCGGG - Intronic
907787365 1:57625766-57625788 GAGAGTGAAGACCGGGAATCAGG + Intronic
908648604 1:66307390-66307412 GAGACAGAGGAGCAGGAACCAGG + Intronic
909725559 1:78830561-78830583 CTGAGTGGTGAGCAGGAGCCAGG - Intergenic
910293794 1:85624333-85624355 CAGCATGAAAAGCAGGAACTTGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
912554130 1:110503985-110504007 GAGAGTGCAAAGCAGGAATCAGG + Intergenic
912754743 1:112314703-112314725 AAGGGTGAAGAGCATGACCCAGG + Intergenic
912908935 1:113736843-113736865 CTGAGAGAAGAGCAGGCACCAGG + Intronic
915980174 1:160415495-160415517 CCCAGTGGACAGCAGGAACCTGG + Intronic
917521060 1:175748787-175748809 GAGAGTGAAGAGCAGAGAGCAGG + Intergenic
917787229 1:178471763-178471785 CAGAGTGAAGACCACGGCCCTGG - Intronic
918558523 1:185835200-185835222 CAGAGTGAAGAGGAGAAGCATGG + Intronic
919849588 1:201663665-201663687 ATGAGAGAAGAGAAGGAACCAGG - Intronic
920491689 1:206420594-206420616 CAGAGCGATGACCAGCAACCAGG + Intronic
921079827 1:211730322-211730344 CAGAGAGAAGAGCAGACACAGGG - Intergenic
921220411 1:212969724-212969746 CCGAGTGGAAAGCAGGACCCAGG - Intronic
921398388 1:214693315-214693337 GAGAGAGAAGAGGAGGTACCAGG - Intergenic
921801770 1:219410652-219410674 GAGAGGCAAGAGCGGGAACCGGG + Intergenic
922435368 1:225599980-225600002 GAGAGAGAAGAGGAGGACCCAGG - Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923110543 1:230886417-230886439 GAGTGGGAAGAGAAGGAACCTGG - Intergenic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1063163072 10:3433906-3433928 TGGAGTGTAGAGCAGGAACTAGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063414377 10:5861541-5861563 CAAAGTGCAAAGCAGGAACAGGG + Intergenic
1063483749 10:6400069-6400091 CCAGGTGAAGAGCAGGAACGTGG + Intergenic
1064414821 10:15139982-15140004 TAGAGAGAAGAGAAGGAACTGGG + Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1065390246 10:25175390-25175412 CAGAGAGAAGAGGAGGGAACGGG - Exonic
1065856642 10:29836496-29836518 CAATGGGAAGAGGAGGAACCTGG - Intergenic
1065876523 10:30001863-30001885 CAGAGTGGTGAGCAGGACTCAGG + Intergenic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1066567438 10:36734979-36735001 GAGAGACACGAGCAGGAACCGGG - Intergenic
1067516377 10:46949208-46949230 CTGAGAGCAGAGCAGGAAACGGG - Intronic
1067522010 10:47014648-47014670 CAGAGTGCTTAGCATGAACCAGG + Intergenic
1067645875 10:48102585-48102607 CTGAGAGCAGAGCAGGAAACGGG + Intergenic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1069196476 10:65556955-65556977 CAGAATGAAAAGCAGGAAAAGGG + Intergenic
1069789358 10:71009876-71009898 CAAAGTGGGGAGCAGGACCCGGG + Intergenic
1070648506 10:78218448-78218470 AAGAGTTTAGAACAGGAACCTGG - Intergenic
1072854938 10:98936582-98936604 CATAGGGAAGAGCAGAAACAGGG - Intronic
1073437786 10:103531575-103531597 CAGAGTGAAGTGCAGTAGCATGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074405530 10:113177526-113177548 CAGGCTGGAGAGGAGGAACCTGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1075049821 10:119175308-119175330 CGGAGTGAAGAGCAGGCAGCAGG + Intronic
1075071690 10:119324186-119324208 CAGAGAGAATAGCAAGAGCCAGG + Intronic
1075420757 10:122298708-122298730 GACAGGCAAGAGCAGGAACCTGG + Intronic
1076690779 10:132222975-132222997 CACAGTGAGGAGCTGCAACCAGG + Exonic
1077819197 11:5719468-5719490 CAGACAGAGGAGCAGGAACATGG - Intronic
1078049543 11:7950423-7950445 CAGAGAGATGAGCAGAAAGCAGG + Intergenic
1078129032 11:8596651-8596673 CTGAATGATGAGAAGGAACCAGG - Intergenic
1078527410 11:12111142-12111164 CCCAGTGAAGAGCTGGAACGGGG - Intronic
1078542202 11:12221706-12221728 GATGGTGAAGAGCTGGAACCAGG + Exonic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080558322 11:33437912-33437934 CAGAATGCAAACCAGGAACCAGG - Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081125025 11:39311829-39311851 GAGAGACACGAGCAGGAACCGGG + Intergenic
1081475195 11:43422836-43422858 TATAGTGAAGAGCAGGAAAATGG + Intronic
1081750889 11:45510510-45510532 CAGAGTCAAATGCAGTAACCTGG - Intergenic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1082857736 11:57824134-57824156 CAGAGTGAAGAACAAGAATAGGG + Intergenic
1083272169 11:61578084-61578106 CAGAGTGTGGAGCTGGAGCCTGG + Intronic
1084009135 11:66338066-66338088 GAGTTTGAGGAGCAGGAACCAGG - Intronic
1084970803 11:72771111-72771133 AAAAGTGAAGTGGAGGAACCAGG + Intronic
1085699390 11:78732611-78732633 GAGCAGGAAGAGCAGGAACCAGG + Intronic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087660106 11:100977343-100977365 CAGTGAGGAGAGCAGGGACCTGG - Intronic
1088423061 11:109669810-109669832 CAGAGTGAAGGACAGGGTCCAGG - Intergenic
1088881851 11:113979099-113979121 GAAAGTGAAGAGCAGGGGCCGGG - Intronic
1089620989 11:119722040-119722062 CAGACGGAAGAGGATGAACCAGG - Intronic
1090464997 11:126925732-126925754 CAGAGAGAAGTGCAGGAGCAGGG - Intronic
1091029781 11:132175343-132175365 CAGCGTGGAGAGCAGGAGCCAGG - Intronic
1091173708 11:133541428-133541450 CAAAGTGAAGAGCAGGAATGCGG + Intergenic
1091215725 11:133900255-133900277 CTGAGTGATGAGCAGGAATAAGG + Intergenic
1091277046 11:134359724-134359746 CAGAGTGAAGCGCAGGTTCTGGG + Intronic
1093064676 12:14644610-14644632 CAGAGTGGACACCAGTAACCAGG - Intronic
1093406258 12:18808550-18808572 CAGAGTGATCAGCAGGAAAATGG + Intergenic
1093884713 12:24446521-24446543 CAGAGAGATGAGCAAGAACTGGG + Intergenic
1094499579 12:31010028-31010050 CAGAGCTAGGAGCTGGAACCAGG + Intergenic
1094526260 12:31233313-31233335 AAGAGAGCAGACCAGGAACCAGG + Intergenic
1096611609 12:52805692-52805714 CAGACTGCAGAGCAGGAGCTGGG + Intergenic
1097400459 12:59122244-59122266 CAGAGAGGACAGCAGTAACCAGG - Intergenic
1097586467 12:61521842-61521864 CAGAATGAAAAGCAGGACACTGG + Intergenic
1098232581 12:68387629-68387651 CTGAATGATGAGGAGGAACCAGG - Intergenic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1100354848 12:93819221-93819243 CTGGATGAAGGGCAGGAACCAGG - Intronic
1100885007 12:99060039-99060061 CAGAGTGGTGAGCAGGCAGCAGG + Intronic
1100885598 12:99066481-99066503 CACAGAGAAGAGAGGGAACCAGG + Intronic
1101819497 12:108173025-108173047 CAGTGAGAAGACCAGGAATCGGG + Intronic
1102389684 12:112539548-112539570 CAGAGTCAGGAGCAGAACCCAGG - Intergenic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103204455 12:119117574-119117596 CACAGTGAACACCAGGAACATGG - Intronic
1103411750 12:120717201-120717223 CAGAGTTTAGAACAGGAGCCAGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104822393 12:131684619-131684641 CATTGTGCAGAGCAGGAAACAGG - Intergenic
1107710534 13:43146326-43146348 CAGATGGAAGAGCAAGGACCTGG + Intergenic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108851650 13:54737636-54737658 GAGAGACACGAGCAGGAACCGGG - Intergenic
1109175515 13:59150573-59150595 CAGATTGGAGATCAGGAACCAGG - Intergenic
1109397779 13:61783115-61783137 CTGAATGATGAGGAGGAACCAGG - Intergenic
1110475554 13:75909373-75909395 CAGGGTGAATTGCTGGAACCCGG - Intergenic
1111434713 13:88191778-88191800 TAGAGTGGAAAGCAGGAACCAGG + Intergenic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1113988686 13:114340973-114340995 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117877404 14:60268289-60268311 TAGAGTGAAGACCAGAAACCTGG - Intronic
1118730944 14:68665879-68665901 CAGGGTGAAGCACAGGACCCAGG + Intronic
1119603437 14:75993714-75993736 CAGATAGCAGAGCAGGAAGCTGG - Intronic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1122288400 14:100666477-100666499 GAGAGTGGAGAGCAGGGACTCGG - Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122703739 14:103607483-103607505 CAGACTCCAGAGCTGGAACCTGG + Intronic
1123488093 15:20758905-20758927 CAGAGTCCAGAGCAGAAACTGGG + Intergenic
1123544593 15:21327978-21328000 CAGAGTCCAGAGCAGAAACTGGG + Intergenic
1126136359 15:45396215-45396237 CAGAGAGAAGACCAGGCTCCAGG - Intronic
1126329833 15:47520348-47520370 CAGAGTGAGGAATAGGAATCAGG + Intronic
1127267443 15:57373708-57373730 GAGAGTGAGGACCAGGAGCCAGG - Intergenic
1128342303 15:66830982-66831004 CTGGGTGAAGAGGAGGAATCAGG + Intergenic
1128598610 15:68976028-68976050 GAGAGGCACGAGCAGGAACCGGG - Intronic
1128670015 15:69567716-69567738 GAGAGGCACGAGCAGGAACCCGG - Intergenic
1128842886 15:70864395-70864417 GAGAGGGAAGAGCAGGGCCCTGG + Intronic
1129577373 15:76764586-76764608 CAGAGCCAAGAGCAAGGACCAGG + Intronic
1129799052 15:78399795-78399817 CAAAGTTCAGAGCAGGATCCAGG + Intergenic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1130009856 15:80142624-80142646 CAGAGTGCAGAGTGGGAATCAGG + Intergenic
1130319982 15:82833498-82833520 GACAGTGATGAGCAGGACCCTGG + Exonic
1130717223 15:86346728-86346750 CACATTGAAGAGGAGGAATCAGG + Intronic
1131373473 15:91903963-91903985 GAGAGTGAAGAGGAGGAAACAGG + Intronic
1133954012 16:10423939-10423961 TAGAGTGTGGAGCAGGAATCGGG + Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1134596183 16:15497879-15497901 GAGAGGGAAGAACAGGAACCCGG - Intronic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135619378 16:23942222-23942244 CAGAGGGAAGTGTAGGAAACTGG + Intronic
1135870594 16:26146366-26146388 CTGAGTGAAGAGGAGGATACAGG - Intergenic
1136418723 16:30118835-30118857 CACAGTTAAGAGCAGCAACTTGG + Intronic
1136534106 16:30889064-30889086 GAGAGGAGAGAGCAGGAACCTGG + Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1141371821 16:83494617-83494639 CAGTGTCCAGAGCAGGAACTGGG + Intronic
1142537782 17:631783-631805 CAGGTTGATGAGCAGGACCCAGG + Intronic
1142941976 17:3387165-3387187 GAGTGTGACTAGCAGGAACCCGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1145022728 17:19444174-19444196 CAGAAGGAAGAGCACGAAGCAGG - Intergenic
1146631671 17:34474416-34474438 CAGAGAGAGGAGCGGGACCCAGG + Intergenic
1147748468 17:42711051-42711073 CAGACTGAAGAACAGGGACAAGG - Intronic
1149673451 17:58436090-58436112 CACAGTAAAGAGCAGAATCCAGG + Intronic
1150368337 17:64611848-64611870 CAGAGAGGTGAGCAGGAGCCAGG - Intronic
1150431398 17:65120811-65120833 CAGAGTGAAGGACAGGATACTGG + Intergenic
1151342059 17:73477803-73477825 GAGGTGGAAGAGCAGGAACCTGG + Intronic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151566560 17:74901706-74901728 CAGAGTCTAGAGCAGGACTCTGG + Intergenic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1153565760 18:6415304-6415326 CAAAGTCAAGAGCAGGAAAGGGG - Intergenic
1153669450 18:7396574-7396596 TAGAGTGGAGAGCAGAAAGCGGG - Intergenic
1153818643 18:8813125-8813147 CAGCGAGAAGAACTGGAACCGGG + Exonic
1154047861 18:10924112-10924134 CAGAGTGGAGAGCAGGAATTGGG - Intronic
1154147057 18:11875118-11875140 CTGAGTGGGGAGCAGGAACAGGG + Intronic
1154404222 18:14073669-14073691 CAGAGTGAAGATCATGATACAGG - Intronic
1155208090 18:23577990-23578012 GAGAGACACGAGCAGGAACCGGG - Intronic
1157575459 18:48740314-48740336 TAGGGGGAAGGGCAGGAACCTGG - Intronic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158339269 18:56448031-56448053 CAAAGTGAAGAGCTTGAACTTGG + Intergenic
1158596525 18:58821463-58821485 CAAAATTAAAAGCAGGAACCAGG + Intergenic
1159065025 18:63560042-63560064 GAGAGAGAAGTGCAGCAACCAGG - Intronic
1159472988 18:68880354-68880376 GAGAGGCACGAGCAGGAACCGGG - Intronic
1160340727 18:78086815-78086837 CAGAGCGAAGACGAGGAGCCAGG - Intergenic
1160938821 19:1610474-1610496 CAGAGTTCAGAGCATGAGCCTGG + Exonic
1161030670 19:2056461-2056483 CAGAGTGAAGAGGAGGGCCTGGG + Intergenic
1162190313 19:8939852-8939874 CAGAGAGAAGAGCTTGAACAAGG - Intronic
1162453016 19:10766059-10766081 CTGAGAGAAGGGTAGGAACCCGG + Intronic
1162641533 19:12014256-12014278 CAGAGTGAAGGGTTGGATCCTGG - Intergenic
1163764193 19:19153328-19153350 CAGAAGGAAGAGCAGGTGCCAGG + Intronic
1163864289 19:19759502-19759524 AAGAGAGAAGAGGAGGAAACAGG - Intergenic
1164230755 19:23285716-23285738 CAGAGTGCAGAGTGGGAATCAGG - Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165430476 19:35768982-35769004 CAGAGAGAAGGGCTGGAAGCAGG - Exonic
1165763559 19:38336464-38336486 CAGAGTGAGGAGCAAGCCCCGGG + Intronic
1166311770 19:41967128-41967150 GAGAGAGAAGAGTGGGAACCAGG + Intronic
1166558329 19:43716272-43716294 CGGTGGGAAGAGTAGGAACCTGG - Intronic
1167259880 19:48452433-48452455 CAGAGGGAAGAGCAGGGGCGGGG + Intronic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167958795 19:53089840-53089862 CAAAATGAGGAGCAGAAACCTGG - Intronic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168690329 19:58372877-58372899 CATACAGCAGAGCAGGAACCGGG - Intronic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
925321842 2:2976381-2976403 CGGAGGGAAGAGCAGGAGTCTGG + Intergenic
925998036 2:9307698-9307720 CAGCATTAAGAGCAGAAACCAGG + Intronic
926063547 2:9820010-9820032 CTGTGTGAAGAGCAGGCTCCAGG - Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
927106223 2:19829740-19829762 CAGAGGGAATAGCAGGTACCAGG + Intergenic
927213043 2:20650523-20650545 CACAGTACAGGGCAGGAACCCGG - Intronic
927404034 2:22747513-22747535 CAGAGTGATGAAGAGGAACAGGG + Intergenic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
928015299 2:27650597-27650619 CAGGGTCAAGAGCAAGAAGCTGG - Exonic
928200980 2:29247378-29247400 GAGAATGAAGCCCAGGAACCTGG + Intronic
928331625 2:30361892-30361914 CAGAGTGGAGATGAGGCACCGGG - Intergenic
928775655 2:34759925-34759947 CAGAATGAAGAGTAGAAGCCAGG - Intergenic
929451873 2:42043296-42043318 CAGAGGGAAGACCATGAATCAGG - Intergenic
929494135 2:42424872-42424894 CAGAGGGAAATGCAGGACCCCGG + Intronic
930224902 2:48782233-48782255 CACATTGAAGAACAGGAACCTGG - Intergenic
930695539 2:54407829-54407851 CAGAGTTCAGAGCAGAGACCTGG + Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
932082490 2:68727616-68727638 CAGAGTGAAGAACAGACTCCAGG - Intronic
932877526 2:75469392-75469414 CAGAGTTAAGATCACAAACCTGG + Intronic
932975959 2:76599880-76599902 CACAGTGCAGTGCAGGAGCCTGG + Intergenic
935695440 2:105767092-105767114 CAGAGAGATAAGCAGGCACCAGG - Intronic
936270071 2:111042544-111042566 CAGAGTGAAGGGCTTGAACAGGG + Intronic
936457637 2:112687442-112687464 CCGAGTGGACAGCAGGACCCTGG - Intergenic
937039827 2:118812722-118812744 CAGAGTGAGCAGCAAGATCCTGG - Intergenic
937209634 2:120260110-120260132 GAGAGGCACGAGCAGGAACCGGG - Intronic
937353806 2:121185632-121185654 CCGGGCGAAGAGCAGGCACCAGG - Intergenic
937452249 2:122011222-122011244 CAGAGTGCAAGGCAGGGACCAGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938241452 2:129745211-129745233 CTGAGAGAAGAACAGGATCCAGG + Intergenic
939189349 2:138897604-138897626 GCGAGTGCAGATCAGGAACCTGG + Intergenic
939898872 2:147826862-147826884 GAGAGGGACGGGCAGGAACCGGG + Intergenic
940572479 2:155456155-155456177 AATAGTAAACAGCAGGAACCAGG + Intergenic
941155727 2:161975787-161975809 CAGAGGGAAGAGCAAGGACAAGG + Intronic
941625267 2:167824517-167824539 CAGAGTTAAGAGGTGAAACCGGG + Intergenic
942509110 2:176677050-176677072 CAAAGTCAAGAGAGGGAACCTGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944868309 2:203883936-203883958 CAGAGCCAAGAGCAGAACCCAGG - Intergenic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
947947713 2:234120765-234120787 CTGAGCAAAGAGTAGGAACCTGG + Intergenic
948048052 2:234958548-234958570 TAGAGTGAAGAGCAGGGGCCAGG + Intronic
948134350 2:235625151-235625173 AAGAGTCTAGAGCAGGCACCTGG - Intronic
948211143 2:236193987-236194009 CAGTGTGCAGGGCAGGAACCAGG - Intergenic
948212749 2:236207158-236207180 CAGGATGCAGAGCAGGACCCAGG + Intronic
948835254 2:240623278-240623300 CAGGGTGAAGGGCTGGAAACAGG + Intronic
1168976482 20:1969803-1969825 CAGAGAGAAGAGCAAGAGCAAGG - Intergenic
1168981483 20:2007634-2007656 CAGATTGAAGAGCAGTAACGGGG + Intergenic
1170686736 20:18576155-18576177 CTGAGTGAAGTGCAGGAAGTTGG + Intronic
1171142443 20:22754965-22754987 CAGAGTGTGGAGCAGGATTCTGG - Intergenic
1171511671 20:25690617-25690639 CAGATTGAAGAGCAGATGCCTGG + Intronic
1172631215 20:36379331-36379353 CAGGGGGAAGAGATGGAACCAGG + Intronic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1173042771 20:39479822-39479844 CAGAGTGGGGATCAGCAACCTGG + Intergenic
1173821357 20:46022252-46022274 CAGAGTGAGGAGGTGGAACTAGG + Intronic
1174759064 20:53188438-53188460 CAAAGTGAAGAGCAGGCTCCAGG - Intronic
1174834091 20:53839800-53839822 CAGGGTGAGGAGCAGGATGCAGG - Intergenic
1174842360 20:53912196-53912218 CCGAGGAAAGAGCTGGAACCTGG - Intergenic
1174984913 20:55440281-55440303 TAGGGTGAAGAGGAGGAACTGGG + Intergenic
1175293410 20:57893212-57893234 CAGAGGCAAGACAAGGAACCAGG - Intergenic
1175852359 20:62100353-62100375 CAGTGTGAAGAGCAGCCGCCTGG - Intergenic
1176312096 21:5157131-5157153 CACAGTGCTGGGCAGGAACCCGG + Intergenic
1176661927 21:9644908-9644930 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1177490656 21:21821843-21821865 AAGAATGGAGAGCAAGAACCTGG - Intergenic
1179412314 21:41171253-41171275 CAGAATGAAGGGCTGGATCCAGG + Intronic
1179543394 21:42099116-42099138 CAGGGTGAAGACCAGCTACCAGG + Exonic
1179844952 21:44104899-44104921 CACAGTGCTGGGCAGGAACCCGG - Exonic
1180981652 22:19880921-19880943 CAGAGTGGAGGGCAGCAAACAGG - Intronic
1181272071 22:21665063-21665085 CCAAGTGGAGATCAGGAACCTGG + Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181772792 22:25138953-25138975 CAGAGGGAAGACCAGGAAGGGGG - Intronic
1182017868 22:27055974-27055996 CAGAGAGGTGAGCAGGGACCAGG + Intergenic
1182420157 22:30245071-30245093 CAGAGTGAAGACTAGGCCCCAGG - Intronic
1182535982 22:31003272-31003294 AAGAGTGAAAACCAGGATCCAGG + Intergenic
1182855574 22:33514926-33514948 CTGTGTGAACAGCATGAACCAGG + Intronic
1183062437 22:35344472-35344494 GAGACTCAAGAGCAGGAACCGGG - Intronic
1184236502 22:43186076-43186098 CAGAGCCAAGAACAGGGACCCGG - Intronic
1184382887 22:44157206-44157228 CAGGGTGCAGAGCTGGGACCTGG - Intronic
1184392338 22:44211663-44211685 CAGAGTGAAGATTAGGGAACGGG - Intronic
1184527821 22:45035898-45035920 TAGAGCCAAGAGCTGGAACCTGG + Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
949284856 3:2389712-2389734 TACAGTGAAGAAAAGGAACCTGG + Intronic
949573046 3:5311822-5311844 AAGACTGAAAAGCAGGAAGCGGG - Intergenic
950154206 3:10709427-10709449 CAGAGAGAAGAGCAGATTCCAGG - Intergenic
950283458 3:11726209-11726231 CGGAGTGAAGAGAAGAAAACAGG - Intergenic
950364886 3:12475883-12475905 CAGAGTACAGAGCAGGGATCTGG - Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951411444 3:22372182-22372204 CAGAGTGAAGAGCGCGGAGCTGG - Intronic
952081587 3:29764852-29764874 CATTGTGAATAGCAGGAACTTGG + Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953538503 3:43793969-43793991 GAGGCTGAAGAGCAGCAACCAGG + Intergenic
954103782 3:48398237-48398259 CAGACTGCAGAGCAAGATCCAGG - Intronic
955346052 3:58162673-58162695 CAAAGTAAAGAGTAGTAACCTGG + Intronic
955531743 3:59880258-59880280 GAGAGAGAAGAGCAGGCACAAGG - Intronic
955911132 3:63861552-63861574 AATAGTGAAGAGCAGGAACTCGG + Intronic
957969843 3:87368672-87368694 CAGAGTAAAGAGGAGGCACTAGG + Intergenic
960149843 3:114238649-114238671 GAGAGGAAAGAGCGGGAACCCGG - Intergenic
961315656 3:126033618-126033640 CAGAGTCATCAGCAGCAACCTGG - Exonic
962061515 3:131932666-131932688 CAGAATGAAGAGCACGCACTGGG + Intronic
962061527 3:131932756-131932778 CAGAATGAAGAGCATGCACTGGG + Intronic
962395099 3:135008751-135008773 CCGAGAGAAGAGCTGGATCCAGG + Intronic
965753271 3:171999230-171999252 CAGAGGCGTGAGCAGGAACCGGG - Intergenic
966183067 3:177204257-177204279 GAGAGGGACGAGCGGGAACCGGG - Intergenic
966511357 3:180766753-180766775 CAGAGTGCAGAGTGGGAATCAGG - Intronic
967251676 3:187546533-187546555 AAGACTGAAGAGAAGGAATCAGG - Intergenic
967982185 3:195072284-195072306 TTGAGTGAGGAGCAGGAACCCGG + Intronic
968239186 3:197060433-197060455 CAGAATGAAAAATAGGAACCTGG - Intronic
968374587 4:28315-28337 CACAGGAAAGAGCAGGATCCTGG + Intergenic
968643090 4:1724635-1724657 CAGAGTAAAGAGCTGCCACCAGG - Intronic
968923373 4:3534083-3534105 TGGAGAGAAGAGCAGGAACGAGG - Intergenic
968931465 4:3581706-3581728 CAGAGTGACCAGCAGGCTCCTGG - Intronic
968943305 4:3650618-3650640 CAGAGAGAAGGGCAGGTGCCAGG - Intergenic
969107322 4:4817501-4817523 CAGAATGATGCGCAGGAGCCAGG - Intergenic
969198262 4:5580619-5580641 CAGAGGGAAGAGCAGGTCCAAGG - Intronic
969372524 4:6742977-6742999 CGGAGTCAACAGCAGGAACGAGG + Intergenic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
970640224 4:18055991-18056013 CAGTGAGAAGAGCATGAACCAGG + Intergenic
972172390 4:36362272-36362294 CTGAGAGTAGAGCAGGAACATGG + Intergenic
972484959 4:39532273-39532295 CAGAGTGAATTGCTTGAACCTGG + Intergenic
973801527 4:54483229-54483251 CAGAGTGAAGGGGAGCAGCCAGG + Intergenic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
974827718 4:67151882-67151904 GAGAGGCAAGAGCGGGAACCCGG + Intergenic
975393936 4:73853458-73853480 CAGAGGTGAGAGCAGAAACCAGG + Exonic
976043910 4:80921474-80921496 CAGAGAGGAGAGCATGAACAAGG + Intronic
976096637 4:81515341-81515363 CAGAGGGGAGGGCAGGAGCCAGG + Intronic
976428716 4:84937360-84937382 CAGGGAGAAGAGGAGGAACTAGG - Intronic
976980336 4:91218328-91218350 GAGAGGCACGAGCAGGAACCGGG - Intronic
977906450 4:102483138-102483160 GAGAGGCACGAGCAGGAACCAGG + Intergenic
978317783 4:107458930-107458952 AAGAATGAGAAGCAGGAACCTGG - Intergenic
980387855 4:132110495-132110517 CTGAGTGAAAAGCGGGAAACAGG + Intergenic
980654741 4:135767086-135767108 CAGAGTGAAGAGCAGGCCTTGGG + Intergenic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
982437925 4:155399303-155399325 CAGGTGGGAGAGCAGGAACCAGG - Intergenic
982731217 4:158957383-158957405 CAGAGAGAAAAGCATGAGCCAGG - Intronic
982981615 4:162144094-162144116 CACAGTGAAGAACAGGGACGAGG + Intronic
983882628 4:172950517-172950539 GAGAATGAAGAGCAGGGACAAGG + Intronic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985413468 4:189711638-189711660 AGGAGTGAAGAGCAGGAAGGTGG - Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
986282672 5:6336419-6336441 CACAGTGCAGGGCAGGAAGCAGG + Intergenic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990726552 5:58761846-58761868 TAAATTGAAGAGCAGGTACCTGG - Intronic
990961654 5:61399829-61399851 CAGAGTAAAGAGCACAAATCTGG + Intronic
991079754 5:62585522-62585544 CAGAGAGCTGGGCAGGAACCAGG + Intronic
991472752 5:66986220-66986242 CAGAGTGCAGGGCAGGTCCCTGG + Intronic
991641307 5:68756966-68756988 CAGAATGAAGAACAGAAACATGG - Intergenic
992018872 5:72602851-72602873 CAGTGAGAAAAACAGGAACCAGG - Intergenic
994170697 5:96656813-96656835 AAGAGTTAAGAGCATGCACCAGG - Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996993571 5:129667271-129667293 CAGAGAAAAGATCAGGACCCAGG - Intronic
997297742 5:132778166-132778188 CAGAGGGAAGAGAAAGAAACGGG - Intronic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
997399952 5:133594491-133594513 AAGAGTGAAGAGCAGGCTTCTGG - Intronic
997510161 5:134448479-134448501 CAGTGAGAAGAGCAACAACCAGG - Intergenic
998143380 5:139712006-139712028 CAGAGGCAAAAACAGGAACCCGG - Intergenic
998439549 5:142145631-142145653 CAGAGTGAAGAGCAAAAATAGGG + Intronic
999173708 5:149616947-149616969 CAGAGTAAAGAGCAGAGACAAGG - Intronic
999409295 5:151336366-151336388 CTGAGGGAAGAACAGGAGCCAGG - Intronic
999649418 5:153750649-153750671 CAGTGTGAGGAGCAGCAACCTGG - Intronic
1000259401 5:159572199-159572221 CACAGTGAAAACCAGCAACCTGG - Intergenic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1003123768 6:3339052-3339074 CAGAGGGAAGAGCAGGGTCGAGG + Intronic
1004115200 6:12759879-12759901 CAGAGTGAGGATCAGAACCCAGG - Intronic
1004151005 6:13120070-13120092 CACAGAGAAGAGGAGGCACCAGG - Intronic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1006341663 6:33450657-33450679 CGGAGCTAAGGGCAGGAACCAGG + Intronic
1006457095 6:34138182-34138204 GAGGGCCAAGAGCAGGAACCAGG - Intronic
1006477794 6:34269028-34269050 GAGAGGCAAGAGCGGGAACCGGG + Intergenic
1007095259 6:39208995-39209017 CAGGGAGAAGTGCTGGAACCCGG + Intronic
1007943714 6:45806218-45806240 CAGAGTGACAGGAAGGAACCAGG + Intergenic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010387887 6:75303339-75303361 CAGCTTGTAGAGCAGGAACATGG + Intronic
1010976907 6:82325616-82325638 CAGAGTGGAGAGCTGGGACTAGG - Intergenic
1011129361 6:84037800-84037822 GAGAGAGAGGGGCAGGAACCCGG - Intronic
1011392420 6:86868245-86868267 CAGAGTATTGAGCAGGAACATGG + Intergenic
1011791234 6:90901387-90901409 CAGAGGGGAGAGAAAGAACCAGG - Intergenic
1012288821 6:97425508-97425530 CAAAGGGAAGAGCAGGTGCCAGG - Intergenic
1013604881 6:111738581-111738603 AAGAGGGAAGAGCAGGCAGCTGG - Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017728703 6:157295407-157295429 AAGAGTGAAGAGAAAGAACCAGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1021785874 7:24152119-24152141 CAGATTGGAAAGCATGAACCAGG + Intergenic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1022278090 7:28876179-28876201 AAGAGTGAAGAGCAGAAAACTGG + Intergenic
1023113859 7:36841231-36841253 CAGAAGGGAGAGTAGGAACCTGG - Intergenic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023814638 7:43940274-43940296 CAGAGTGATGAGCAGGTACCAGG - Intronic
1023967201 7:44969228-44969250 ACAAGTGAAGAGCAGGAAACAGG - Intronic
1024525408 7:50344414-50344436 ATGTGTGAAGAGAAGGAACCTGG - Intronic
1027316118 7:76986257-76986279 GTGAATGGAGAGCAGGAACCAGG - Intergenic
1027948861 7:84786310-84786332 CTCAGTGTAGAGCAGGAGCCTGG - Intergenic
1029306934 7:99626452-99626474 CTGGGGTAAGAGCAGGAACCAGG + Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1030091785 7:105864490-105864512 GGGAGTGAAGCACAGGAACCAGG - Intronic
1030112451 7:106038423-106038445 CAGAGTGATGAGCATGAGGCTGG + Intergenic
1031584027 7:123512198-123512220 CAAACTGAAGAGCATGAATCTGG - Exonic
1032339612 7:131058765-131058787 GAGAGTCACGGGCAGGAACCAGG + Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1033366861 7:140678562-140678584 GAGAGTGAAGGGCAGGTGCCGGG + Intronic
1033900331 7:146130835-146130857 GAGAGAGAAGAGCATGAAGCGGG + Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1034889010 7:154822775-154822797 CAGGATGAAGAGCAGGAAATAGG - Intronic
1037784141 8:21892669-21892691 CAGAGGGAGGACCAGAAACCTGG - Intergenic
1037954287 8:23042135-23042157 CAGGGTCAAGACCAGGAAGCAGG - Intronic
1038362046 8:26889941-26889963 CAGAGAGCAGAGCAGGATGCAGG + Intergenic
1038378896 8:27073652-27073674 CAGTGGAAAGAGCAGGAACTTGG + Intergenic
1038638241 8:29304255-29304277 GAGAGGCACGAGCAGGAACCGGG + Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1039409647 8:37342199-37342221 AACAGGGAACAGCAGGAACCAGG + Intergenic
1039635634 8:39161729-39161751 CAGAGTTAAGGTCAGGGACCAGG + Intronic
1039706477 8:40012695-40012717 AACAGTGAAGAACAGGAATCAGG + Intronic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1045030508 8:98130659-98130681 TAGAGAAAAGAGTAGGAACCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045808626 8:106195156-106195178 CAGATTTAATAGCAGGAACAAGG - Intergenic
1046979456 8:120321023-120321045 AAGAGTGAAGTGTAGGACCCAGG - Intronic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047422510 8:124718704-124718726 TTGAGTGCAGAGCAGGAAGCGGG - Intronic
1048687866 8:136924670-136924692 AAGAGTGAATCCCAGGAACCTGG - Intergenic
1048917917 8:139202143-139202165 CAGTGTGGAGAGCTGGACCCTGG + Intergenic
1049284903 8:141769336-141769358 CTGAGGGAACAGCAGAAACCAGG - Intergenic
1049453398 8:142674976-142674998 CAGAGGGAATAGCAGGCACGGGG - Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1054458665 9:65450223-65450245 CAGAGTGACCAGCAGGCTCCTGG + Intergenic
1054826910 9:69582555-69582577 CAGAGTCAGAAGCAGGTACCAGG - Intronic
1057158881 9:92870752-92870774 CAGCATGAAGAGCAGAAACAAGG + Intronic
1057255199 9:93540751-93540773 CAGAGTGAAGAGGAGGTCACAGG - Intronic
1057936002 9:99239468-99239490 CACAGTGAAGAGGGGGAACAAGG + Intergenic
1057997655 9:99833996-99834018 GAGAGCCAAAAGCAGGAACCAGG - Intronic
1058176034 9:101737729-101737751 CAGAGGGATGAGCCGGAGCCAGG - Exonic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059302373 9:113324432-113324454 CAGACTGCAGTGCAGGGACCTGG + Intronic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059393435 9:114015972-114015994 CAGAATGAAGAGTGGGGACCAGG + Intronic
1059761433 9:117341266-117341288 CAGAGAGAAATGCAGCAACCAGG - Intronic
1060053435 9:120392984-120393006 GAGAGGGAGAAGCAGGAACCAGG - Intronic
1060849974 9:126866483-126866505 CAGAAGGAAAAGCAGGAACAGGG - Intronic
1061464527 9:130767044-130767066 CTGAGTGAAGGGCAGGGCCCAGG - Intronic
1062024460 9:134333881-134333903 GAGAGGGAAGAGCAGGCAGCGGG - Intronic
1203574632 Un_KI270744v1:165835-165857 CACAGGAAAGAGCAGGATCCTGG - Intergenic
1203639488 Un_KI270750v1:146751-146773 AGGAGTGAAGAGCAGGAAGGTGG + Intergenic
1186280951 X:7992518-7992540 CAGAGGACAGAGCTGGAACCAGG - Intergenic
1187087991 X:16061751-16061773 CAGGGGGAACAGCAGGTACCAGG - Intergenic
1188619667 X:32204775-32204797 CAAAGGGGAGAGCAGGAAACAGG + Intronic
1191035543 X:56022696-56022718 CACAGTGAAAAGCAGCAACGTGG + Intergenic
1191720306 X:64223463-64223485 CAGATTGAAGGGCAGGAATGAGG + Intergenic
1193615338 X:83680966-83680988 CAGAGTTAATAGTAGGAAACAGG + Intergenic
1193867326 X:86750919-86750941 AAGTATGAAAAGCAGGAACCTGG - Intronic
1194844382 X:98786304-98786326 CAGATTCAAGAGGAGGAAACAGG - Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198676929 X:139140924-139140946 CAGAGAGAAGAGCAGACACAAGG - Intronic
1199028840 X:142972496-142972518 GAGAGGCACGAGCAGGAACCGGG - Intergenic