ID: 1059380398

View in Genome Browser
Species Human (GRCh38)
Location 9:113919176-113919198
Sequence GGCTGGCAGGAAAGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059380389_1059380398 27 Left 1059380389 9:113919126-113919148 CCATCTCGTAGAGCAGAAAGAGC No data
Right 1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG No data
1059380388_1059380398 28 Left 1059380388 9:113919125-113919147 CCCATCTCGTAGAGCAGAAAGAG No data
Right 1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG No data
1059380387_1059380398 29 Left 1059380387 9:113919124-113919146 CCCCATCTCGTAGAGCAGAAAGA No data
Right 1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG No data
1059380386_1059380398 30 Left 1059380386 9:113919123-113919145 CCCCCATCTCGTAGAGCAGAAAG No data
Right 1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG No data
1059380391_1059380398 5 Left 1059380391 9:113919148-113919170 CCAAGAGTGTGAGCAGCCAAGGG No data
Right 1059380398 9:113919176-113919198 GGCTGGCAGGAAAGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059380398 Original CRISPR GGCTGGCAGGAAAGTGAGAC AGG Intronic