ID: 1059382375

View in Genome Browser
Species Human (GRCh38)
Location 9:113936194-113936216
Sequence GACCCAGGTCTGTCTGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 1, 2: 6, 3: 53, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059382375_1059382382 16 Left 1059382375 9:113936194-113936216 CCAGAGGCAGACAGACCTGGGTC 0: 1
1: 1
2: 6
3: 53
4: 327
Right 1059382382 9:113936233-113936255 CTGACCAGTTATGTTACCATGGG No data
1059382375_1059382381 15 Left 1059382375 9:113936194-113936216 CCAGAGGCAGACAGACCTGGGTC 0: 1
1: 1
2: 6
3: 53
4: 327
Right 1059382381 9:113936232-113936254 CCTGACCAGTTATGTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059382375 Original CRISPR GACCCAGGTCTGTCTGCCTC TGG (reversed) Intronic
900202004 1:1412154-1412176 GTCCCAGGTCCGTCTGTCCCAGG + Intergenic
900202014 1:1412186-1412208 GTCCCAGGTCCGTCTGTCCCAGG + Intergenic
900495728 1:2975192-2975214 GTCCCAGGGCCGTCTGTCTCTGG - Intergenic
901873936 1:12155268-12155290 GACCTAGGGCTGGCTGGCTCAGG + Intergenic
902271501 1:15308360-15308382 GGCCCAGGCCTGGCTGCCACTGG - Intronic
902272426 1:15314365-15314387 GACCCTGGTCTGTGTGCCCCCGG - Intronic
903291513 1:22317247-22317269 GATCCGGGTCTGTCTGAATCTGG + Intergenic
903335601 1:22622190-22622212 GACCCAGCTCTTTCCTCCTCAGG - Intergenic
903375573 1:22863700-22863722 GTCCCAGGACTGTCTACCTTGGG - Intronic
903570565 1:24301441-24301463 ATCCCACGTCTGTCTGACTCAGG - Intergenic
904585673 1:31579306-31579328 GAACCAAGTCTGTCAGCCACAGG - Intronic
904596397 1:31648730-31648752 CACCCACCTCTGTCTGCCTCAGG - Intergenic
904747110 1:32718122-32718144 AACCCAGGCCTTTCTGGCTCTGG + Intergenic
904771340 1:32882851-32882873 AACCCAGTTCTGTGTGACTCAGG - Intergenic
904974254 1:34443626-34443648 AACTCGGGTCTGTCTGTCTCTGG - Intergenic
905003075 1:34688620-34688642 TGCCCAGGTCTGTCTGGCCCTGG - Intergenic
905182146 1:36174055-36174077 AACCCAAGTCTGTCTGACTTAGG - Intronic
905478222 1:38243653-38243675 GAAGCAGGGATGTCTGCCTCTGG + Intergenic
905547826 1:38813918-38813940 GACCCAGGTTCCTCTGCTTCTGG + Intergenic
905867906 1:41386252-41386274 GACCGAGCTCTGCCTGGCTCAGG + Intergenic
905933972 1:41809047-41809069 CAGCCAGGTCTGTCTGCCTCTGG + Intronic
905935210 1:41817926-41817948 AACCCAGGCCAGTCTCCCTCAGG - Intronic
906173401 1:43747427-43747449 ACCCCAGGTATCTCTGCCTCTGG - Intronic
906680890 1:47724989-47725011 TGCCCTGGTCTGTCTCCCTCAGG - Intergenic
906712095 1:47938340-47938362 GTCCCAGCTCTATCTGTCTCTGG + Intronic
906725632 1:48042112-48042134 GAGCCAGGTCTGTCTGGTCCTGG - Intergenic
908052173 1:60245378-60245400 GGCCCAGCTCTGTCTGACTTTGG + Intergenic
908097703 1:60757737-60757759 AACCCGGTTCTGTCTGGCTCTGG - Intergenic
908249489 1:62253916-62253938 CACTCAGGTCTGTCCGGCTCTGG + Intronic
912712905 1:111962253-111962275 AACCCAGGTCTGCCTGCCTTTGG + Intronic
913155337 1:116091946-116091968 GTCCCAGATCTTTCTGCTTCTGG - Intergenic
914215896 1:145627880-145627902 CACCAAGGTCTTTCTGCCTCAGG - Intronic
914467839 1:147948265-147948287 CACCAAGGTCTTTCTGCCTCAGG - Intronic
914826363 1:151140402-151140424 GATCCAGGTCTGTCTGCCTCTGG + Intronic
916207407 1:162328688-162328710 AATCCAGGTCTGTCCCCCTCAGG + Intronic
919616902 1:199819236-199819258 GCCCCAGGTGTGTCTGTGTCCGG - Intergenic
922410157 1:225365641-225365663 GTCCCTGTTCTGTCTGCCCCAGG - Intronic
922775201 1:228211346-228211368 CAGGCAGGTCTGCCTGCCTCAGG + Intronic
923331416 1:232928375-232928397 GACCACTGTCTATCTGCCTCTGG - Intergenic
923765147 1:236886361-236886383 CACCCAGGTCTGTTTGGCTATGG + Exonic
924137776 1:240988793-240988815 GTCCTAGTTCTGTCTGCCTTTGG + Intronic
924643393 1:245854960-245854982 GACGGAGGTCTATCTGGCTCTGG + Intronic
1062802626 10:391350-391372 GACCCAGGTCTTCCTTCCTCTGG - Intronic
1063577521 10:7275128-7275150 GCCCCAGGTCTGCCTCCCTGCGG - Intronic
1063654152 10:7970455-7970477 GGCCCAGGCCTGTCTGCCCGAGG + Intronic
1063662870 10:8046011-8046033 AACCCAGATGTGTCTGCATCTGG + Intergenic
1063733333 10:8723845-8723867 CACCCTGGACTCTCTGCCTCAGG - Intergenic
1064552579 10:16519665-16519687 GCCCCGGGTCTATCGGCCTCTGG - Intronic
1066543009 10:36469476-36469498 TACCCAGGTCTGTGTGCCCCAGG + Intergenic
1067458530 10:46440666-46440688 GAGCCAGGAGTGTCTGCCCCAGG + Intergenic
1067628669 10:47943970-47943992 GAGCCAGGAGTGTCTGCCCCAGG - Intergenic
1069580111 10:69560016-69560038 GGCCCAGGTGTGCCTGGCTCTGG - Intergenic
1069831787 10:71286231-71286253 GACCCAGGTCTGCCAGACCCGGG + Intronic
1071182892 10:83007255-83007277 ATTCCAGGTCTGTCTGACTCTGG + Intergenic
1071848546 10:89544796-89544818 AAACCAGGTCTGTCTAACTCTGG + Intronic
1073425688 10:103454311-103454333 GACCCAGTTCTGTCTCACTCTGG + Exonic
1074782096 10:116809361-116809383 AATCCAGGTGTGTCTGACTCCGG - Intergenic
1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG + Intronic
1075605105 10:123799287-123799309 GACCCAGTGCCATCTGCCTCTGG - Intronic
1076295179 10:129378439-129378461 GCCCCAGGCCTAGCTGCCTCTGG + Intergenic
1077503687 11:2920520-2920542 ACCCCAGCTCTGTCTGTCTCAGG - Intronic
1077614510 11:3665513-3665535 GGTCCAGGTCTGTCTACTTCAGG - Intergenic
1078431615 11:11292567-11292589 GACCCAGCACTGTCTACATCTGG + Intronic
1080406948 11:31987762-31987784 AACCCAGGTTTATCTGTCTCAGG - Intronic
1081858614 11:46319311-46319333 AACCCAGGTCTGCCTGGCCCTGG - Intronic
1081936291 11:46906070-46906092 AACCCAAGTCTGTCTGCTCCAGG - Intronic
1081997588 11:47375283-47375305 AACCCAGGTCTGTCCGCTCCAGG - Intronic
1083227057 11:61291876-61291898 GCCCCAGGGGTGGCTGCCTCAGG + Intronic
1083613654 11:64016030-64016052 GACCCAGGTCTTCCTGCAGCGGG - Intronic
1083855817 11:65392574-65392596 GACCCAGGACTCAATGCCTCAGG - Intronic
1083868403 11:65471407-65471429 GAGCCAGGGCTGGCTGTCTCAGG + Intergenic
1084575205 11:69984694-69984716 TAGCCGGGTCTGTCTCCCTCAGG + Intergenic
1085350124 11:75792891-75792913 GAACCAGGGCTGTCTGCTTTGGG + Intronic
1085392378 11:76189055-76189077 AACCCAGGTCTGTCCAGCTCTGG - Intronic
1085444545 11:76591673-76591695 GACCCAGGTCTCCCTGCTCCCGG - Intergenic
1085707956 11:78803480-78803502 AACCCAGGTCTGTCTGACTCAGG + Intronic
1088734772 11:112719603-112719625 AACTCAGCTCTGTCTGCCACTGG + Intergenic
1088920499 11:114257198-114257220 GACCCGGGTCTGTCTGACCCTGG + Intergenic
1090393501 11:126404748-126404770 GACCAGGGTCAGACTGCCTCAGG - Intronic
1091342539 11:134828386-134828408 GACCCAGGTCTGTGGACCCCTGG + Intergenic
1091638481 12:2215811-2215833 GCCCCAGGCCTGCCTGCCTGGGG + Intronic
1094446433 12:30535674-30535696 GACCCTGGTCTGTCTGCTAGCGG + Intergenic
1094701592 12:32875641-32875663 TACACAGGGCTCTCTGCCTCTGG - Intronic
1098108041 12:67091531-67091553 GAGCCAGGTGAGTTTGCCTCCGG - Intergenic
1098293619 12:68982044-68982066 TACCCAGGTCTGTTTCACTCAGG - Intergenic
1098858753 12:75684009-75684031 CAGCCATGTCTGTCTGACTCTGG + Intergenic
1099556606 12:84116018-84116040 TTCCCAGGTGTTTCTGCCTCAGG - Intergenic
1101822148 12:108192377-108192399 AACCCAGGTCTGTTTGCCTGTGG + Intronic
1101837173 12:108303780-108303802 CCCCCAGGTCCCTCTGCCTCTGG + Intronic
1102805048 12:115772308-115772330 GAACCAGGTTTGTCTGCTTAGGG - Intergenic
1102809270 12:115809864-115809886 GAACCTAGTTTGTCTGCCTCTGG - Intergenic
1102927377 12:116836399-116836421 AACCCAGGTCTGGCTGACTCCGG - Intronic
1103513377 12:121490448-121490470 GACCCAGCCATGACTGCCTCTGG - Intronic
1103598247 12:122037401-122037423 GACCCAGGGCTGTCTTGTTCTGG + Intronic
1104947521 12:132423272-132423294 GACCCAGCCCTGTCGGCCTCAGG + Intergenic
1105844220 13:24281003-24281025 TACCCATGTCTGTCTGGCTGGGG - Intronic
1106996320 13:35486603-35486625 GAGCCAGGTCTGTCTGACTGTGG + Intronic
1107887825 13:44889155-44889177 AACCCAGGTCTCCCTACCTCTGG + Intergenic
1109501115 13:63236823-63236845 CACCCAGGTTTGTTTGCCTGAGG - Intergenic
1109793689 13:67282361-67282383 GTATAAGGTCTGTCTGCCTCTGG + Intergenic
1110091052 13:71448858-71448880 GACCCAACTCTGTAGGCCTCAGG - Intronic
1110560615 13:76907612-76907634 GACCCTGGTGGCTCTGCCTCGGG + Intergenic
1111455524 13:88478440-88478462 GTCTCATGTCTTTCTGCCTCAGG - Intergenic
1111555910 13:89881069-89881091 GAAACAGGTAAGTCTGCCTCTGG + Intergenic
1112076268 13:95916520-95916542 GGCCCAGTTCTGTCTGCTTAGGG - Intronic
1112414482 13:99192917-99192939 CACCCATGTCTCTCTGCCTGAGG + Intergenic
1112437878 13:99404585-99404607 CACCGAGGTCTGGCTGCCTCCGG - Intergenic
1113617366 13:111690243-111690265 GAGTCAGGTATGCCTGCCTCTGG - Intergenic
1113622895 13:111775513-111775535 GAGTCAGGTATGCCTGCCTCTGG - Intergenic
1114675581 14:24437958-24437980 GTCTCAGGTGTGTCTGCCTGTGG + Exonic
1118255399 14:64201171-64201193 GGCCCAGGTCTGCTTGCCTCTGG + Intronic
1118458643 14:65967846-65967868 AACCCAGGTCTGATTGACTCAGG + Intronic
1118554816 14:67006287-67006309 GTCCTATTTCTGTCTGCCTCAGG + Intronic
1119179698 14:72597441-72597463 GAGCCAGGGCTGTGGGCCTCAGG + Intergenic
1119431483 14:74570777-74570799 GGCTGAGCTCTGTCTGCCTCTGG + Intronic
1119653750 14:76401969-76401991 GTCCCAAGTCTGCCTGCCTTTGG - Intronic
1121238172 14:92408532-92408554 GAGCCAGGTCTGTGTGGCTTGGG + Intronic
1121321225 14:92992753-92992775 CAGCCAGGTCTGTCTGACTCAGG - Intronic
1121448801 14:93995093-93995115 GACTCATGTCTGTGTGGCTCAGG - Intergenic
1121509119 14:94499288-94499310 CAGCCAGGTCTGCCTGGCTCTGG + Intronic
1122767991 14:104085016-104085038 GGTCCAGCTCTGCCTGCCTCTGG + Intergenic
1122870066 14:104634410-104634432 GACCCAGGTCAGTCGGATTCGGG - Intergenic
1123682986 15:22775864-22775886 GGCCCAGCCCTGTGTGCCTCTGG + Intronic
1123763013 15:23446987-23447009 GACCCAGCCCAGTGTGCCTCTGG + Intronic
1124463101 15:29911262-29911284 AACTCAGCTCTGTCAGCCTCTGG - Intronic
1126533123 15:49732397-49732419 GGCCCCGGGCTGTCTGCCTCTGG + Intergenic
1126949257 15:53862233-53862255 GTTCCAAGTCTGTCTGCATCTGG - Intergenic
1127386678 15:58472896-58472918 AACCCAGGTGTGTCTGACTACGG + Intronic
1127753230 15:62066807-62066829 GACCCAGTTCTTTCTCTCTCCGG - Intergenic
1128112973 15:65088082-65088104 GACCCAGGACTGACAGCCCCAGG - Intergenic
1128398766 15:67255155-67255177 GAAGCAGGACTTTCTGCCTCTGG + Intronic
1128570047 15:68727076-68727098 GACCCTGGTCTGCCTTCCCCAGG - Exonic
1128674930 15:69601524-69601546 GACCCAGGTCTCTCGGCTCCAGG - Intergenic
1128998443 15:72314036-72314058 CACCCAGGTCTCTCTGACTCAGG + Intronic
1129362610 15:75033795-75033817 GACAGAGCTCTGTCGGCCTCTGG + Intronic
1129390416 15:75217472-75217494 GCCCCAGGTCTGTCTTCCCTTGG + Intergenic
1129732097 15:77938489-77938511 GCCCCAGGTCTGTCTTCCTTTGG - Intergenic
1131538516 15:93256785-93256807 AACCCAGGTCTGCCTGATTCAGG - Intergenic
1132177873 15:99729544-99729566 GCGCCTGCTCTGTCTGCCTCTGG + Exonic
1132592881 16:733996-734018 GCCTCAGGCCTGGCTGCCTCTGG + Intronic
1132768359 16:1546626-1546648 CACCTAGGCCTGTCTCCCTCGGG + Intronic
1133322346 16:4922126-4922148 GACCCCGGGCTGTCTGGCTTTGG - Intronic
1133829721 16:9310378-9310400 GACCTAGGTCTTTCTGACTCAGG - Intergenic
1134237466 16:12478604-12478626 GACCCAGGTCTGTCTTCTCCAGG - Intronic
1135023254 16:18980073-18980095 AACCGAGGTCTCTCTGGCTCAGG + Intergenic
1136245945 16:28975762-28975784 AACCCAGGTCTGTCTTCACCTGG - Intronic
1137598080 16:49738023-49738045 GTCCTAGGTCTCTCTGTCTCGGG - Intronic
1137677725 16:50311946-50311968 TAGCCAGGTCTGTCTGTCCCTGG - Intronic
1138220016 16:55242478-55242500 GACTCTGCTCTGACTGCCTCCGG - Intergenic
1139201471 16:64981766-64981788 GAGCTGGGCCTGTCTGCCTCAGG - Intronic
1139966361 16:70747700-70747722 CACCCAGGTCTGTCTGCACAGGG + Intronic
1140263542 16:73400982-73401004 GGGCCAGGTCTGTCTGGCTCCGG + Intergenic
1140453018 16:75086893-75086915 GCCCCAGTTCTGCCTGTCTCTGG - Intronic
1141916213 16:87098966-87098988 AACCCAGGTCTGTCTTCTTCTGG - Intronic
1142241362 16:88948342-88948364 GACCAACGTCTCTCTGCCTGGGG - Intronic
1143599975 17:7938708-7938730 AACCCAGGTCTACCTGGCTCTGG + Intronic
1143881742 17:10035234-10035256 GACCAAGGTGTGGCTGCCTTGGG - Intronic
1144482607 17:15640119-15640141 GAACCAAGACTGTCTGTCTCTGG + Intronic
1144500873 17:15786276-15786298 GTCCCAGGTCTGTCCGTCTGGGG + Intergenic
1144916080 17:18724913-18724935 GAACCAAGACTGTCTGTCTCTGG - Intronic
1145062003 17:19739450-19739472 AACCCAGGTCTGTGGGCCCCAGG + Intronic
1145203820 17:20969738-20969760 GCCCCAAGTCTGGATGCCTCTGG + Intergenic
1146061062 17:29607664-29607686 GCTCCAGGGCTGTCTGGCTCCGG + Intronic
1146157172 17:30534529-30534551 AATCCAGGTCAGTCTGACTCTGG + Intergenic
1146837774 17:36126069-36126091 GACCCACCCCTGTCTGCCTAGGG + Intergenic
1148350763 17:46940408-46940430 GACCTAGATCTGTCTAACTCTGG + Intronic
1148974026 17:51511161-51511183 CAGCCAGGTCTGCCTGCGTCTGG + Intergenic
1151591649 17:75047960-75047982 GACCCAGTTCTGGATGCATCTGG - Intronic
1152577853 17:81150732-81150754 GGCCCCTGTCTGTCTGCCTTAGG - Intronic
1152820865 17:82437045-82437067 GACCCGGGCCTGGCTGTCTCAGG + Intronic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1153004614 18:486592-486614 GACACAGGTCTGTGGGACTCAGG + Intronic
1156560687 18:38122175-38122197 GAGCCAGGCCTGACTGCCGCAGG - Intergenic
1157098552 18:44709419-44709441 GAACATGGTCTCTCTGCCTCTGG + Intronic
1157553449 18:48597256-48597278 GTCACAGGTCTGTCTCCCGCTGG - Intronic
1157695323 18:49717895-49717917 GATCCAGGCCTTGCTGCCTCCGG - Intergenic
1160985250 19:1835682-1835704 GGCCCAGGTCAGTCTGTTTCTGG + Intronic
1161126370 19:2560339-2560361 CCCCCAGGTCTGTCTCCCACCGG + Intronic
1161284197 19:3460324-3460346 AACTCAGGCCTGTCTGGCTCTGG - Intronic
1161390135 19:4016384-4016406 GTACCAGGGCTATCTGCCTCTGG - Intronic
1163827770 19:19533174-19533196 AACCCAGGTGTGTCTGGCTCTGG + Intronic
1165313444 19:35041541-35041563 GACCCAGGTGTGCCTGTCTGCGG - Intronic
1165416828 19:35699600-35699622 GACCCAGATCTGCCTGACCCAGG - Intergenic
1165767975 19:38362555-38362577 GACCGAGTTCTGACTGCGTCCGG - Exonic
1166748895 19:45155474-45155496 GAGCCTGGGCTTTCTGCCTCAGG + Intronic
1167135132 19:47611095-47611117 GACCCAGGGCTGTGTGACCCTGG - Intronic
1167620328 19:50556783-50556805 GACCCAGGGCTCCTTGCCTCGGG - Intronic
1167960825 19:53103171-53103193 GCCCCCGGTCTTTCTGCCTTGGG - Intronic
1168148855 19:54434383-54434405 GTCCTGGATCTGTCTGCCTCTGG + Intronic
1168545010 19:57242868-57242890 AACCCAGGTCCCTCTGCTTCAGG - Intronic
925274429 2:2638654-2638676 GACCCAGCTCTGTGTGGCTCTGG + Intergenic
926053429 2:9759213-9759235 GACCCAGGAATTTCTGCATCAGG - Intergenic
926057179 2:9780915-9780937 GACCCGGGTTTGTCTGCCTCGGG + Intergenic
926096726 2:10086071-10086093 GTCCCAGCTCTGGCTGTCTCTGG - Exonic
928065692 2:28162344-28162366 CATCCAGGTCTGTCTGACTTTGG - Intronic
928120954 2:28583097-28583119 AAGCCAGCTCTGTCTGGCTCTGG - Intronic
928274744 2:29890308-29890330 GGCCCAGGCCTGTTTGACTCTGG - Intronic
929533293 2:42765256-42765278 AACCCAGGCCTGTCTGCATATGG - Intergenic
932137063 2:69240720-69240742 AACCCAGCTCTGTTTGCCTCAGG - Intronic
933635982 2:84709357-84709379 GATCCAGGACTGTCAGTCTCTGG + Exonic
934679746 2:96274909-96274931 GGACCAGGTCTGTGGGCCTCAGG - Exonic
936715040 2:115176819-115176841 GAACCTGGATTGTCTGCCTCTGG + Intronic
936974743 2:118207812-118207834 GACCCAGCTCTGGCTGCTTCTGG + Intergenic
937011781 2:118569353-118569375 AGTCCAGGTCTGTCTGCTTCAGG + Intergenic
937098933 2:119253970-119253992 GAGCCAAGGCTGTGTGCCTCAGG + Intronic
937926454 2:127171337-127171359 GGCGCAGGGCTGTCTGCCTGTGG - Intergenic
937975029 2:127577230-127577252 GACCCAGAGCATTCTGCCTCTGG + Intronic
940106716 2:150109385-150109407 GACCAAAATATGTCTGCCTCAGG + Intergenic
941264786 2:163348159-163348181 GGCCCAGGTCTGGCTGGCTCAGG + Intergenic
942061151 2:172229763-172229785 AAACCAGGTCTGTCTGGCTATGG - Intergenic
945037155 2:205714298-205714320 AGCCCAGCTCTGTCTGCTTCTGG + Intronic
945428221 2:209734433-209734455 TACTCAGGTGTATCTGCCTCAGG + Intergenic
945734940 2:213587342-213587364 GACCCAGGTATGGCTGACCCAGG - Intronic
946449738 2:219769487-219769509 GACCGAGGCCTGCCTGCCTCCGG - Intergenic
947354793 2:229280792-229280814 AACTCAGGTCTGTCTGACTCTGG - Intergenic
947848500 2:233264820-233264842 CAGCCAGGTCCGTCTGGCTCTGG + Intronic
1169088392 20:2841051-2841073 AGCCCAGGTCTGTTAGCCTCCGG + Intronic
1169235216 20:3925079-3925101 AACCCGGGACTGTCTGTCTCTGG + Intronic
1170221227 20:13944134-13944156 TACCCAAGTCTGTCTACCTCAGG - Intronic
1170569584 20:17625303-17625325 GACCCAGGGCTGACTGCCTGTGG - Intronic
1171823478 20:29875564-29875586 GGCGCAGGGCTGTCTGCCTGTGG + Intergenic
1171896617 20:30814763-30814785 GGCGCAGGGCTGTCTGCCTGTGG - Intergenic
1172701842 20:36858141-36858163 AACCCAGGTTTGTCTAACTCTGG - Intronic
1172980309 20:38936647-38936669 AACCCAGGTCTCTGTGACTCCGG - Intronic
1173841919 20:46163056-46163078 ACCCCAAGTCTGTCTGGCTCCGG - Intergenic
1173958253 20:47051468-47051490 AACCCAGGAGTGTCTGCCTCGGG - Intronic
1174112814 20:48207918-48207940 GACCCAGATCAGTCTCCCTAAGG - Intergenic
1174251934 20:49226408-49226430 GACCCAGTTCTTTTTTCCTCAGG + Exonic
1174286675 20:49479000-49479022 AACCCAGGTCCCTGTGCCTCTGG - Intronic
1175456938 20:59122608-59122630 TACTCAGGTCTGTCTGACTCCGG - Intergenic
1175598952 20:60257214-60257236 AGCCCAGGTCTGTCTGACTCTGG + Intergenic
1175948159 20:62568301-62568323 AACACAGGGCTGTCTGCCCCAGG + Intronic
1176017664 20:62944347-62944369 GACCCAGGTCCCTCTTCCCCCGG + Intronic
1179009020 21:37539119-37539141 CACCAAGGTCTGATTGCCTCAGG + Intergenic
1179354664 21:40648443-40648465 GACCCACCACTGTCTGCCTAGGG - Intronic
1180260269 21:46663597-46663619 CACCCAGGCCTGTCTCCCTGAGG - Intronic
1181783154 22:25207378-25207400 GCCCCAGGCCTGGCTCCCTCAGG - Intergenic
1182428629 22:30287774-30287796 AACCCAGGTCTGTCTGAATCTGG - Intronic
1183277971 22:36913338-36913360 AACACAGATCTGTCTGGCTCTGG + Intergenic
1183285257 22:36958613-36958635 AACCCGGGTCTGTCTGGCTCTGG - Intergenic
1183326576 22:37197861-37197883 CACCCAGGTTTGTCTGCCCCAGG - Intronic
1183927940 22:41219170-41219192 GACTCGGTTCTGTCTGACTCTGG + Intronic
1184421009 22:44382924-44382946 GACCCTGGTCAGGCAGCCTCGGG + Intergenic
949510465 3:4762457-4762479 GATCCAGGCCTTTCTGACTCTGG + Intronic
949833291 3:8240139-8240161 GTCCCAGCTCTGTCTGCGGCTGG - Intergenic
950125710 3:10508663-10508685 GACCCAGGTGTATCTGCTGCAGG - Intronic
950677384 3:14562734-14562756 GTCCGAGGACCGTCTGCCTCGGG - Intergenic
952919869 3:38276906-38276928 GCCCCATGCCTGTCTGCCTGGGG - Exonic
953439804 3:42907501-42907523 AACCCAGGCCTGTTTGACTCTGG - Intronic
953497619 3:43402060-43402082 CACCGAGGTTTGTCAGCCTCTGG - Intronic
954315431 3:49798875-49798897 GCCCCAGGTGTGACTGTCTCTGG + Exonic
954625726 3:52021007-52021029 GAGCCAGGGCAGTCTGCCTGTGG + Intergenic
956483307 3:69694841-69694863 GACTCAGGTCTCTCTGACTCTGG + Intergenic
958990255 3:100835089-100835111 GACCCAGGCCTGCCTGCTTTTGG + Intronic
960312654 3:116135432-116135454 AACCCAGTTTTGTCTGGCTCTGG + Intronic
960738929 3:120811360-120811382 AACCCAGGTCTTTCTACCACAGG - Intergenic
961634633 3:128325293-128325315 GACCCAAGCCTCTGTGCCTCAGG + Intronic
962314228 3:134349036-134349058 GACCCATGTGTGCCTGCCTGAGG + Intergenic
962927331 3:140007254-140007276 AACTCAGATCTGTCTGCTTCTGG - Intronic
966779626 3:183572870-183572892 AATTCAGGTCTGTCTGACTCTGG - Intergenic
966784784 3:183613421-183613443 AACCCAGTTCTCTCTGACTCCGG + Intergenic
967182169 3:186915384-186915406 GATCCAGGTCTTTCTTACTCTGG + Intergenic
968496950 4:923758-923780 GTCCCAGGCCAGGCTGCCTCAGG - Intronic
968631027 4:1651613-1651635 GACCCCGGTTATTCTGCCTCAGG - Intronic
968759888 4:2437216-2437238 GAGCCAGGTCTGTCTGCCCTGGG - Intronic
969355316 4:6621578-6621600 AACCCAGGACTTTCTGCCTAAGG + Exonic
969591192 4:8122838-8122860 GACCCAGGCCTCTCTGACCCTGG + Intronic
972703365 4:41515723-41515745 AACCCAGGTCTTTCTGTCTCTGG + Intronic
974438686 4:61889314-61889336 CACCCTGTTCTTTCTGCCTCAGG - Intronic
975647227 4:76557011-76557033 AACCCGGGTCTGTCTGAATCCGG - Intronic
975650300 4:76586281-76586303 GTCTCAGCTCTGTCTTCCTCGGG + Intronic
976010778 4:80486289-80486311 CACCCAGGGCTGCCTGCCTAGGG + Intronic
976803364 4:89018597-89018619 AACCCAGGTCTGGCGGCCTTGGG + Intronic
980862644 4:138517933-138517955 GACCCAATTCTGTCTGACTTCGG - Intergenic
981098093 4:140802370-140802392 GTCACAGGTCTGTGTCCCTCTGG + Intergenic
982085480 4:151831265-151831287 GTCCCAGGGTTGTCTGCCTTTGG - Intergenic
982724497 4:158891150-158891172 GAGGCAGGTCTCTCTGTCTCTGG + Intronic
985444923 4:190016608-190016630 GACACCGGGCTGTCTGCCTATGG + Intergenic
985491028 5:179567-179589 TGCCCAGGTCTCTCTGCCTGGGG - Intronic
985727038 5:1522085-1522107 GCCCCAGCTATGGCTGCCTCAGG - Intronic
985791034 5:1926828-1926850 GTCCGAGCTCTGGCTGCCTCCGG + Intergenic
986536517 5:8793705-8793727 GACTCAGGTCGATCTGACTCTGG + Intergenic
987243852 5:16028515-16028537 AACCCAGGACTGTCTGACTCTGG + Intergenic
988855816 5:35227335-35227357 AGCCCAGGTCTGTCTGACTTTGG - Intronic
989095599 5:37778409-37778431 GGCACCGGGCTGTCTGCCTCTGG + Intergenic
995044977 5:107635431-107635453 GACACAGAGCTGGCTGCCTCTGG + Intronic
996900286 5:128537026-128537048 GACCCAGGCCCGCCTGCCGCCGG + Intronic
997689259 5:135814623-135814645 GTCCCAGGTCCCTCTGACTCCGG - Intergenic
997690692 5:135825776-135825798 GACCATGGTCTTTATGCCTCAGG + Intergenic
998315148 5:141175759-141175781 ATCCCAGATCTGTCTGACTCTGG + Exonic
1000121410 5:158201441-158201463 GAGCCAGGTCTGTCTGCTTCTGG + Intergenic
1000494219 5:161958337-161958359 GACTCAGGTCTATTTGACTCCGG - Intergenic
1001171967 5:169427976-169427998 GATCCAGGTCTGCATGACTCAGG - Intergenic
1001407314 5:171485230-171485252 AACCCAGGTCTCTTTGCCTCTGG + Intergenic
1001605352 5:172955876-172955898 TACCCAGGTCTGCCTGACTCTGG + Intergenic
1001948402 5:175798532-175798554 CACACAGCTCTGTCTGCCTGGGG - Intronic
1002943510 6:1739088-1739110 GACCCAGGTCTTCATGCCTGTGG - Intronic
1003127932 6:3370612-3370634 GACTCAGGTCTGTGTGCCCAAGG + Intronic
1004272537 6:14208680-14208702 GACTCAGAGCTTTCTGCCTCAGG + Intergenic
1004477345 6:15986165-15986187 AACCCAAGTCTGCCTGTCTCTGG - Intergenic
1005179184 6:23084223-23084245 GAGCCAGGTCTGTCTGCAAGAGG + Intergenic
1007586610 6:42994352-42994374 AACCCAGGTCTGTGTGACTCTGG + Intronic
1009243462 6:61205395-61205417 GACCCAGGTATCTCTGCATCTGG - Intergenic
1009288045 6:61847356-61847378 GACCTAGGACTGTCTTTCTCAGG + Intronic
1009961018 6:70521514-70521536 GACCCAGGTTTATCTGCTTAGGG + Intronic
1010242753 6:73631767-73631789 CATCCATGTCTGTCTCCCTCTGG + Intronic
1010445831 6:75947904-75947926 GACACAGGTCAGTCTGCTCCTGG - Intronic
1012451466 6:99356540-99356562 CACCCAGGGCTGTCTTCATCAGG - Intergenic
1012976113 6:105782762-105782784 CTCCCAGGTCTGTCTTCCTCTGG - Intergenic
1014687440 6:124520056-124520078 GATGCAAGCCTGTCTGCCTCTGG + Intronic
1014800931 6:125777291-125777313 GACCCAGCTCTCTGAGCCTCTGG - Intergenic
1015751242 6:136561392-136561414 TACCCTGGTCTGTAAGCCTCAGG + Intronic
1016385015 6:143522468-143522490 TACCCAGCCCTGCCTGCCTCTGG + Intergenic
1016767910 6:147815542-147815564 GTCCCTGCTGTGTCTGCCTCAGG - Intergenic
1019022294 6:168929496-168929518 GACCCAGTTCTGTGTGGCTGGGG - Intergenic
1019023412 6:168938323-168938345 ACACCAGGTCTGTCTGACTCAGG + Intergenic
1019181423 6:170189398-170189420 GCCCCAGGTCTGTCCTCCTAGGG + Intergenic
1020046755 7:5046198-5046220 GACCCAGATCCGCCTCCCTCGGG - Exonic
1022037253 7:26546188-26546210 AACTCAGGTTTTTCTGCCTCTGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023879746 7:44311746-44311768 GACCCAGGCCTGAAGGCCTCTGG - Intronic
1023984927 7:45088836-45088858 GGCCCGGGTCGGTCCGCCTCGGG + Exonic
1024200472 7:47101379-47101401 GAACCAGGTCTGTCGGCAGCAGG + Intergenic
1024283403 7:47737493-47737515 GACCAAGGGCTGTCCGCCTGGGG + Intronic
1025853877 7:65262281-65262303 GACCCTGGTCTGGGTGTCTCAGG - Intergenic
1026592750 7:71711035-71711057 AACCCAGGTCTCCCTGCCCCGGG + Intronic
1029223440 7:99008263-99008285 GACCCGGCTCTGTATGCCTTGGG - Intronic
1029634373 7:101774104-101774126 GACCCTGGCCTGACTTCCTCTGG - Intergenic
1029739108 7:102482061-102482083 GAGCCAGGTCTGGGGGCCTCAGG + Intergenic
1029757109 7:102581240-102581262 GAGCCAGGTCTGGGGGCCTCAGG + Exonic
1029775050 7:102680301-102680323 GAGCCAGGTCTGGGGGCCTCAGG + Intergenic
1031019554 7:116612415-116612437 GAGGCAGATCTCTCTGCCTCTGG - Intergenic
1031061800 7:117060181-117060203 ACCCAAGGTCTGTGTGCCTCAGG - Intronic
1031196827 7:118626764-118626786 GACCCACCCCTGTCTGCCTTAGG - Intergenic
1035064457 7:156095003-156095025 GCCCCAGGCCTGCCTACCTCAGG - Intergenic
1035205703 7:157292768-157292790 GACCCAGTTCCGCCTGCCCCCGG - Intergenic
1035258169 7:157645363-157645385 GTCCCAGGTCTCCCAGCCTCAGG - Intronic
1035680156 8:1482003-1482025 GAACCAGGTCTGTGTTCCTCGGG + Intergenic
1036750474 8:11440542-11440564 GACCCAGCACTGCCTGCCTCTGG + Intronic
1037399185 8:18476530-18476552 AACCCAGGGCAGTCTGACTCAGG + Intergenic
1037945627 8:22987806-22987828 GCCCCAGATCTGGCTGCCACAGG - Intronic
1040890814 8:52314274-52314296 GACACAGGACTGTGTGCCGCTGG + Intronic
1041208446 8:55522718-55522740 AACCCAGTTCTGACAGCCTCCGG + Intronic
1041405188 8:57491153-57491175 AACCCAGGTCTGTATGTATCTGG - Intergenic
1041643629 8:60229341-60229363 GACCCCAGTCTGTCTCCCTGGGG - Intronic
1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG + Intergenic
1042510955 8:69610403-69610425 GAAACAGGTTTGTCTGCTTCTGG - Intronic
1042762410 8:72285148-72285170 GGCACCGGTCTGTCTGCCTGTGG + Intergenic
1043189898 8:77205304-77205326 AGCCAAGATCTGTCTGCCTCCGG + Intergenic
1044533843 8:93337745-93337767 GAGCCAGGTGGGGCTGCCTCTGG - Intergenic
1044939096 8:97322216-97322238 CACCTACCTCTGTCTGCCTCTGG - Intergenic
1045551328 8:103175156-103175178 GACTCAGCTCTGTCTTTCTCAGG + Intronic
1046693790 8:117315745-117315767 GTCCCAACTCTGTCTGCTTCAGG - Intergenic
1047448844 8:124944255-124944277 ACCCCAAGTCTGTCTGCTTCAGG + Intergenic
1048063198 8:130941930-130941952 AACCCATGTCTGTCTGACTGTGG + Intronic
1048351730 8:133621974-133621996 GACCCCAGGCTGTCTGGCTCAGG - Intergenic
1048675696 8:136776856-136776878 GATCCAGGGCAGTCTGACTCTGG - Intergenic
1049003519 8:139840796-139840818 CACCAAGGCCTGGCTGCCTCTGG + Intronic
1049041152 8:140112773-140112795 AACCCAGGTCTGTCTGGTTTGGG + Intronic
1049159732 8:141089551-141089573 GCCCCAGTTCCGTCTGTCTCTGG + Intergenic
1051692643 9:19732721-19732743 AACCCAGGCCTGCCTGTCTCAGG + Intronic
1052424134 9:28282071-28282093 CACCCAGGTAAGTCTGCATCTGG - Intronic
1053267106 9:36723507-36723529 GACCCAGGTCTGCCTGCTCCTGG + Intergenic
1055790139 9:79914828-79914850 GACCCAGACTTTTCTGCCTCAGG + Intergenic
1056765847 9:89443913-89443935 GGCCCAGGGCTGCCTGACTCTGG - Intronic
1057368272 9:94444877-94444899 TACCCAGGTCTGCCTGCTGCAGG - Intronic
1058959566 9:109979924-109979946 CATCCAGGCCTGTCTGCGTCTGG - Intronic
1059344101 9:113616631-113616653 GAGCCCTGTCTGTCTGCCCCTGG + Intergenic
1059382375 9:113936194-113936216 GACCCAGGTCTGTCTGCCTCTGG - Intronic
1059949147 9:119443668-119443690 GACCCAGATCTCTCTGACTTTGG + Intergenic
1060150465 9:121285038-121285060 GGCCCAGACCTGTTTGCCTCTGG - Intronic
1060656371 9:125375113-125375135 GAACCTGGTGTGTCTGCCTCGGG - Intergenic
1061012978 9:127966238-127966260 GACCTAGATGTGTCTGACTCTGG - Intronic
1061175508 9:128993688-128993710 GAACCAAGTAAGTCTGCCTCTGG + Exonic
1061439505 9:130590946-130590968 AACCCAGGTCTGCCTGACTCTGG - Intronic
1062010423 9:134264002-134264024 GACCCTGGTCTGCCTGGCTGGGG + Intergenic
1203376547 Un_KI270442v1:382079-382101 GGCGCAGGTCTGTCTGCCTGTGG + Intergenic
1185652387 X:1657798-1657820 GACCCAGGCCTGCCTGTCTTGGG + Intergenic
1186734079 X:12442240-12442262 GTCACAGGGCTGTTTGCCTCAGG + Intronic
1187027271 X:15448593-15448615 AACCCAAGTTTGTCTACCTCTGG - Intronic
1187191437 X:17038924-17038946 AACCCAAGTCTGTCTGCCTCTGG + Intronic
1187797020 X:23014991-23015013 GGCTCAGGTCTTTCTGACTCCGG - Intergenic
1190302057 X:49062663-49062685 CACCCAAGTCTGTCTACCTAGGG - Intronic
1192299566 X:69885993-69886015 GACCTAAGTGTGTCTCCCTCTGG - Intronic
1197761330 X:130030516-130030538 GAAAAAGGCCTGTCTGCCTCTGG + Intronic
1198159637 X:133994774-133994796 GACCCAGGACTATCTGACTGTGG - Intergenic
1198992884 X:142536597-142536619 GAACCAGGCCAGTCTGCATCTGG + Intergenic
1200277997 X:154751992-154752014 GACACAGCTCTGGCTGCCTATGG - Intergenic