ID: 1059383996

View in Genome Browser
Species Human (GRCh38)
Location 9:113950007-113950029
Sequence CAGGATCTACGGGGGTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059383996 Original CRISPR CAGGATCTACGGGGGTTTAA TGG (reversed) Intronic
900429614 1:2595532-2595554 CAGGCTCTGGGGAGGTTTAATGG + Intronic
902380460 1:16050113-16050135 CAGGAGATATGGGGGTTAAATGG - Intronic
902755171 1:18544695-18544717 CAGGGTCTCAGGGGGTTTAGTGG - Intergenic
908638284 1:66192522-66192544 CATGATCTTCCGGGGTTTCATGG - Intronic
911275648 1:95854449-95854471 CAGGAACCACAGGGGCTTAAAGG - Intergenic
915635765 1:157185460-157185482 CAGGCAGTACTGGGGTTTAATGG + Intergenic
1070671784 10:78382543-78382565 CAGAATCTGCAGGGGTCTAAGGG - Intergenic
1071952276 10:90717394-90717416 GAGGATCTGCAGGAGTTTAATGG + Intergenic
1072337618 10:94412928-94412950 CAGGATCTACTTGGGTCTCAAGG - Intronic
1092947107 12:13466717-13466739 CAGGATTTACATGGGTTTGAGGG + Intergenic
1122198410 14:100107173-100107195 GAGGACCTACAGTGGTTTAATGG - Intronic
1127118953 15:55754642-55754664 GAGGCACTCCGGGGGTTTAAAGG + Intergenic
1127572583 15:60258793-60258815 CAGGATCCATGGTGGATTAAAGG + Intergenic
1137845261 16:51681525-51681547 CAGAATTTTCTGGGGTTTAAAGG - Intergenic
1142123282 16:88397479-88397501 CAGGATCTCAGGGGGTTAAAGGG + Intergenic
1143439398 17:6957447-6957469 CAGGTTCTGCGGGGGTTTAGTGG - Intronic
1153757504 18:8299109-8299131 CAGGATCTCTGGAGGTTTAAAGG - Intronic
930632871 2:53772879-53772901 CAGGTTCTACTGGGGTCTACGGG - Intronic
946337961 2:219050880-219050902 AAGGGTCTACTGGGGTTCAAGGG - Intergenic
1172939581 20:38645261-38645283 AAGGAACTATGGGGGTATAAGGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
961054523 3:123776887-123776909 CAGGATCTACAGGGGCATAGTGG - Intronic
962600068 3:136984847-136984869 CAGGATCTGGGGGAGATTAAGGG + Intronic
977193730 4:94032663-94032685 CAGGATGTAAGGGGAATTAAGGG - Intergenic
997014624 5:129918531-129918553 CAGGATACACAGGAGTTTAAGGG + Intronic
997516436 5:134493154-134493176 CAGGATCTGGGGAGATTTAAGGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1004999052 6:21222650-21222672 CAGGACATACAGGGGATTAAGGG - Intronic
1008101949 6:47401285-47401307 CAGGATCCAGGGAGGTTTCAGGG + Intergenic
1022877004 7:34544622-34544644 TAGGGTCTCCGGGGGTTTACAGG - Intergenic
1029102422 7:98143068-98143090 CAGGATCTACTGGGGATGGATGG + Intronic
1031970197 7:128059242-128059264 CAGGTACTAGGGGGGTTCAAGGG - Intronic
1034069783 7:148173109-148173131 CGGAATCTACTGGGGATTAAAGG - Intronic
1034076175 7:148233318-148233340 AGGGATCTAAGGGGGTTTACAGG + Intronic
1050223254 9:3420846-3420868 CAGGATCTAAGGGATTTAAATGG - Intronic
1050326042 9:4498171-4498193 AAGGAGCTAAGGGGGTTCAAAGG + Intronic
1052316758 9:27123348-27123370 AAGGATATGCGGGGGTGTAAAGG + Intronic
1055217305 9:73881283-73881305 GAGAATCAACTGGGGTTTAACGG + Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1062692087 9:137847119-137847141 CAGGCTTTAAGGGGATTTAAGGG + Intronic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189035840 X:37492831-37492853 CAGGATCTGCGGGGGTGGAAGGG + Intronic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic