ID: 1059388751

View in Genome Browser
Species Human (GRCh38)
Location 9:113985559-113985581
Sequence CGGGCTGCTGCCACCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059388751_1059388762 25 Left 1059388751 9:113985559-113985581 CCCACAAAGGTGGCAGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1059388762 9:113985607-113985629 CTGCTCACCCACGAGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059388751 Original CRISPR CGGGCTGCTGCCACCTTTGT GGG (reversed) Intronic
900199703 1:1398956-1398978 GGGGCGGCAGCCGCCTTTGTTGG - Intronic
900786025 1:4651167-4651189 GGGCCTGCTGGCTCCTTTGTTGG + Intergenic
904015684 1:27418573-27418595 TGGGCTGCTGACAGCCTTGTGGG - Intronic
904466699 1:30712372-30712394 GGGGCTGCTGCCATCTGCGTTGG + Exonic
907456458 1:54579552-54579574 GGGGCTGGGGCCACCTTTGTGGG + Intronic
908494375 1:64679774-64679796 CTGGCTGCTGCCTCCCCTGTGGG - Intronic
912132423 1:106619442-106619464 AGGGCTGCTGCCTGCTCTGTGGG - Intergenic
914998541 1:152565942-152565964 CTGGCTGCTGCCACGGTTCTGGG - Exonic
915017135 1:152744572-152744594 CTGGCTGCTGCCACAGCTGTAGG + Intronic
915123617 1:153648266-153648288 GGGGCTGCTGCCACCATTAAGGG - Intergenic
915510717 1:156385598-156385620 CGGGCTGCTGCTAGCTTATTAGG - Intergenic
916069042 1:161159515-161159537 GGGGCCGCCGCCATCTTTGTTGG - Exonic
920514004 1:206570837-206570859 TGGGTTGCTTCCACCTTTTTTGG + Intronic
921218575 1:212957301-212957323 TGGGTTGCTTCCACCTTTGGGGG + Intronic
921543380 1:216446309-216446331 GGTGCTACTTCCACCTTTGTTGG + Intergenic
1067429957 10:46236396-46236418 TGGGCTCCTGCCACCTTTTCAGG + Intergenic
1069090598 10:64195515-64195537 CAGGCTGCTGACTCCTTTGCAGG + Intergenic
1072734032 10:97867190-97867212 CAGGCTGCTGGCACCTTTGAAGG - Exonic
1073212704 10:101818033-101818055 CCGGCCGCTGCCACCTCTGCGGG + Exonic
1073473177 10:103736362-103736384 CGGGCTGCTGCCAGCTGGGCTGG + Intronic
1076093687 10:127712960-127712982 CTGCCGGCTGCCACCTTTGCAGG + Intergenic
1076484485 10:130807332-130807354 CAGGCTGCTGCCACCTTTTGGGG + Intergenic
1076563428 10:131382047-131382069 GGTGCAGCTGCCACCTTTGGGGG + Intergenic
1077213993 11:1387642-1387664 CTCCCTGCTGCCATCTTTGTGGG - Intergenic
1077487148 11:2844263-2844285 CATGCTGCTGCCCCCCTTGTGGG - Intronic
1078068775 11:8094899-8094921 AGGGTGGCTGCCACCTGTGTGGG + Intronic
1078858883 11:15229065-15229087 CGGGCTGCCTCCAAATTTGTTGG + Intronic
1078901626 11:15648022-15648044 CTGGCTGCAGCCCCCTTTGATGG + Intergenic
1081490061 11:43560625-43560647 TGGGCTACTGCCAACATTGTGGG + Intronic
1082101877 11:48179537-48179559 CGGGATGCTGGCGTCTTTGTTGG + Intergenic
1083805873 11:65073640-65073662 GGGGCTCCTGACACCTTAGTGGG - Intronic
1084268478 11:68016915-68016937 TGGGCTACTGCTGCCTTTGTAGG - Intronic
1085392900 11:76191538-76191560 AGGCCTGCTGCCACCTTGGTGGG - Intronic
1089358592 11:117871975-117871997 CTGGCTGCAGCCACCTCTGCAGG - Intronic
1092713011 12:11357588-11357610 CAGGCTGCAGCAACCTTGGTTGG - Intronic
1096257350 12:50071576-50071598 CTGGCTGCTTTCAGCTTTGTGGG + Intronic
1096921372 12:55089833-55089855 CTAGCTGCTGCTATCTTTGTAGG + Intergenic
1100311119 12:93395595-93395617 CAGGCTGCTGCCACATTATTTGG - Intronic
1102198221 12:111039504-111039526 AAGGATGCTGACACCTTTGTGGG + Intronic
1106115045 13:26810443-26810465 GTGACTGCTGGCACCTTTGTGGG - Intergenic
1106411511 13:29514444-29514466 GGGGCTGCTGCCACCTCCGGGGG + Exonic
1109371620 13:61428284-61428306 CAGGCTGCTTCCACCTATGGTGG + Intergenic
1110308579 13:74020361-74020383 TGTGTTGCTGCCATCTTTGTAGG - Intronic
1124071065 15:26393549-26393571 CGGGCTCCTGATACCTTAGTTGG + Intergenic
1127056265 15:55135371-55135393 CTGGCTTCAGCCACCTTTCTAGG - Intergenic
1129268614 15:74408106-74408128 GGGGCTGCTGCCACCATTTTTGG - Intergenic
1131024899 15:89132139-89132161 CTTGCTGCTGCCTCCATTGTTGG - Intronic
1132833357 16:1940615-1940637 TGCGCTGCAGCCACCTTTCTGGG + Intronic
1133032518 16:3018036-3018058 CGGGCTGCGGCCACCTGGATGGG - Intronic
1134688793 16:16177398-16177420 CTGGCTCCTGCCACCCTTGGGGG - Intronic
1137958059 16:52852934-52852956 CAGGCTGCTGCCACCAGTGCTGG - Intergenic
1142129821 16:88427529-88427551 CGGGCTGCTGGCAACTTGGCGGG - Exonic
1142327466 16:89425503-89425525 GGGGCTCCTGGCACCATTGTGGG - Intronic
1148811776 17:50297609-50297631 CCTGCTGCTCCCACCTGTGTGGG - Intergenic
1150226866 17:63529168-63529190 CTGGCTGCAGCCCCCTTTGGTGG - Intronic
1150302152 17:64055697-64055719 GGGGCTGCTGCCAGCCTTGGAGG + Exonic
1151264302 17:72942221-72942243 CTGGCTGCTACCTCCTTTCTGGG - Intronic
1151477197 17:74350831-74350853 CGGGCTGCGGCCACCTCGGGTGG - Exonic
1153003836 18:480218-480240 CAGGGTGCTGTCACCTTTGGGGG + Intronic
1156230777 18:35152183-35152205 CTGGCTTCAGCCACCTTTCTAGG + Intergenic
1158622101 18:59041566-59041588 CTGGCTTCGGCCACCTCTGTTGG - Intergenic
1160810146 19:1009803-1009825 CTGGCTGCTGCCACTGATGTTGG + Exonic
1166741631 19:45118124-45118146 AGGGCTGCAGCTACCTCTGTAGG - Intronic
1167299966 19:48672573-48672595 CAGGCGGCTGCCACCTGAGTGGG - Intronic
1167797925 19:51722147-51722169 GTGGCTGCTGACACCTGTGTTGG - Intronic
928030523 2:27774559-27774581 AGGCCTGTTGCCCCCTTTGTAGG + Intronic
932217927 2:69978731-69978753 CGGGCTGCTACCACCTTGGAGGG - Intergenic
934915002 2:98294437-98294459 CTGGCTGTTGCCACTGTTGTCGG + Intronic
935092112 2:99905155-99905177 CTGGCTGCTCACAACTTTGTGGG + Intronic
936457598 2:112687258-112687280 CGCGCTGCTACCATATTTGTGGG - Intergenic
945064998 2:205940897-205940919 CTTGCTGTTGCCACCTGTGTTGG + Intergenic
945654270 2:212604788-212604810 AGAGCTGCTGCCACCTTGCTAGG + Intergenic
946630021 2:221656951-221656973 AGGTCTGCTGCCACCTTCATAGG - Intergenic
948250413 2:236523956-236523978 TGGGCTGCTGGCCCGTTTGTTGG + Intergenic
948920457 2:241063818-241063840 AGGGCTGCGGCCACCTTGGGAGG + Intronic
1171271748 20:23823607-23823629 GGAGCTGCTGCCACTTTTGGAGG - Intergenic
1171411165 20:24949737-24949759 CTGGCTGCAGCTACCTTTGGGGG + Intronic
1171447187 20:25213184-25213206 CGTGCTGCTTCCACCCTTTTGGG - Intronic
1172114173 20:32563835-32563857 GGGGCTGCTGCCACCTTGGCCGG - Intronic
1172446741 20:34997213-34997235 GGGGCAGCTGTCACCTCTGTGGG - Intronic
1173593920 20:44247081-44247103 CGGGCTCCTTCCACCCTTGCAGG + Intronic
1174059594 20:47823277-47823299 CAGGCTACTGCCACCTTCCTGGG - Intergenic
1174664544 20:52245728-52245750 GGTGCTGCTGCCCTCTTTGTGGG - Intergenic
1174930139 20:54804684-54804706 CAGGCTGAGGCCACCTCTGTGGG - Intergenic
1175956438 20:62612002-62612024 CGGGCAGCTGCCAGCCTGGTGGG - Intergenic
1179135345 21:38675628-38675650 CGGGCTGCTGCTGCCCTTGCCGG - Intergenic
1179635822 21:42708261-42708283 AGGGCTGCTGCTGTCTTTGTTGG - Intronic
1180857971 22:19060045-19060067 GGGGCAGCTGCCACCGTGGTGGG - Intronic
1181464228 22:23102164-23102186 GGGGCTGCGGCCACCTCAGTGGG + Intronic
1181929044 22:26384607-26384629 GGTGATGCTGCCACCTTAGTGGG - Intergenic
1182304429 22:29358175-29358197 CAAACTGCTGCCACCATTGTGGG + Intronic
1182348165 22:29681561-29681583 CTTGCTGCTGCCACCCCTGTCGG - Exonic
1184358132 22:43996161-43996183 CCGGCTGCTTCCTCCTTTGCTGG - Intronic
1184880316 22:47300419-47300441 CGGTCTCCAGCCACCTCTGTTGG + Intergenic
951421249 3:22488326-22488348 CTGGCTGCTTCCAGCTTTGGGGG - Intergenic
954380280 3:50215588-50215610 AGGGCTGCTGCCAGCTTTCCTGG - Exonic
954461877 3:50631543-50631565 AGTGCTGCTGGCACCTGTGTGGG - Intronic
956707651 3:72013084-72013106 GGGGCTGCTCACACTTTTGTGGG + Intergenic
960692643 3:120363034-120363056 CAAGCTGCTGCCACCTTTAAGGG - Intergenic
962176409 3:133160163-133160185 AGGGCTGCTGCTCCTTTTGTGGG + Intronic
966893953 3:184428324-184428346 GGGGCTGCTGCCACCTCACTGGG + Intronic
968646561 4:1744072-1744094 CAGGCTGCTGCCCCCTCTGGGGG - Intronic
969167695 4:5331027-5331049 CAGGCTGCCTCCACATTTGTTGG - Intronic
974785067 4:66609391-66609413 AGGCTTGCTGCCACCATTGTGGG + Intergenic
975921889 4:79400791-79400813 CTCCCTGCTTCCACCTTTGTGGG - Intergenic
985331868 4:188846072-188846094 CGGGCTGCTTCCACTTATGCTGG - Intergenic
989241950 5:39212003-39212025 CCAGCTGCTGCCACCTGTCTTGG - Intronic
992411552 5:76510517-76510539 CTGGCTGCTGCCATCTGTGCTGG + Intronic
997643487 5:135465294-135465316 GGGGATGCTGACCCCTTTGTGGG + Intergenic
1002299668 5:178250147-178250169 CTGGCTGCTGACACCTCTTTAGG - Intronic
1002778969 6:352150-352172 CTGGCTGCTGCCTCCTGAGTGGG - Intergenic
1004160051 6:13205119-13205141 CTGGCTGCTTCCACCTATGGAGG + Intronic
1007975842 6:46100425-46100447 GGGGCTGCTTGCACCTTGGTGGG + Intergenic
1010930809 6:81800822-81800844 CAGGCTGCTTCCACCCTTGATGG + Intergenic
1017711244 6:157170221-157170243 AGATCTGCTGCCAGCTTTGTGGG + Intronic
1017806281 6:157948214-157948236 AGAGCATCTGCCACCTTTGTAGG - Intergenic
1018670233 6:166170844-166170866 CTGGATTCTGCCATCTTTGTAGG - Intergenic
1019606290 7:1911868-1911890 CCAGCTGCGGCCACCTTTGCAGG + Intronic
1021613846 7:22482558-22482580 CAGGCTGCTGGCCCCATTGTGGG - Intronic
1024996908 7:55279194-55279216 CGGGCTGCTGACACCACTGTGGG - Intergenic
1025033514 7:55575841-55575863 GGGGCTGCTACTACCTTTATGGG + Intergenic
1025235313 7:57230715-57230737 CAGGCTACTGTCACCTTCGTGGG + Intergenic
1026846194 7:73700334-73700356 CTGGCTGCTGCCACCTGGCTGGG - Exonic
1028520147 7:91721064-91721086 CCTGCTGCTGCCACCATTGCTGG + Intronic
1028755299 7:94427125-94427147 CAGGCTGCTGCTCCCTTGGTGGG + Intronic
1040319451 8:46285344-46285366 AGCCCTGCTGCCACCTGTGTGGG + Intergenic
1041890099 8:62858937-62858959 TGGGCTGCAGACACCTTTGTTGG + Intronic
1046964405 8:120147872-120147894 CTGGTTGCTTCCACCTTTTTTGG + Exonic
1048172197 8:132117816-132117838 CGGGCTGTTGCTAGCTTTGCAGG + Intergenic
1049672908 8:143877680-143877702 AAGGCTGCTGCCTCCTGTGTGGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057992294 9:99782998-99783020 AGTGCTGCTACCATCTTTGTAGG - Intergenic
1059388751 9:113985559-113985581 CGGGCTGCTGCCACCTTTGTGGG - Intronic
1060479298 9:124008702-124008724 GGGGCTGGTGGCCCCTTTGTTGG + Intronic
1060656880 9:125378078-125378100 CGGCCTGCTGCCTCCATTCTAGG + Intergenic
1061931422 9:133834934-133834956 GGGGCTTCTGCTCCCTTTGTAGG - Intronic
1191684788 X:63878968-63878990 CTGGCTGCTGCCACCAAGGTAGG + Intergenic
1193649078 X:84108763-84108785 CCGGCTGCTGCCACCTCACTAGG + Intronic
1197378240 X:125709160-125709182 GGGGCTGCTGCCTGCTTTGTGGG - Intergenic
1198136967 X:133762863-133762885 AGGGCTGGTGCCACCTAAGTGGG - Intronic
1201906468 Y:19090851-19090873 CTGGATGCTGCCAACATTGTTGG - Intergenic