ID: 1059389247

View in Genome Browser
Species Human (GRCh38)
Location 9:113988518-113988540
Sequence GATCTCGGCAGGCACGTCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059389247_1059389252 -6 Left 1059389247 9:113988518-113988540 CCAGCGACGTGCCTGCCGAGATC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1059389252 9:113988535-113988557 GAGATCTGCGTGGTGATCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 53
1059389247_1059389250 -9 Left 1059389247 9:113988518-113988540 CCAGCGACGTGCCTGCCGAGATC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1059389250 9:113988532-113988554 GCCGAGATCTGCGTGGTGATCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1059389247_1059389253 18 Left 1059389247 9:113988518-113988540 CCAGCGACGTGCCTGCCGAGATC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1059389253 9:113988559-113988581 GTCCGCAACCAGCAGACCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059389247 Original CRISPR GATCTCGGCAGGCACGTCGC TGG (reversed) Exonic
902869366 1:19304451-19304473 GATCTCAGCAGGGAGGTGGCTGG - Intronic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
920572179 1:207025335-207025357 GAGCTGGGCAGGCACATGGCAGG + Intronic
1072782631 10:98260933-98260955 GCTGTCGACAGGCACCTCGCTGG + Exonic
1077386193 11:2270582-2270604 GGTCTCCGCAGGCGCGGCGCAGG + Exonic
1084066223 11:66705797-66705819 GACCTGGGCAGGCACCTAGCAGG - Exonic
1112507226 13:99982283-99982305 GAGCTCGGCGTTCACGTCGCAGG + Exonic
1113055247 13:106260401-106260423 GAGATCGGCAAGCACGTTGCCGG + Intergenic
1113539213 13:111093507-111093529 GATCCCTGCAGGGACGTCTCAGG - Intergenic
1132655613 16:1040617-1040639 GACCTCGGCAGGAACCTCGGTGG - Intergenic
1142226604 16:88880733-88880755 GATGTCCTCAGGCACGTAGCCGG + Exonic
1150170156 17:62986337-62986359 GCTCCTGGCAGGCACGTCCCAGG - Intergenic
1156372658 18:36485233-36485255 GATCCCAGCAGGCTCATCGCTGG - Intronic
1161285252 19:3465041-3465063 GACCTCGGGAGCCAGGTCGCAGG - Intronic
1161590421 19:5126897-5126919 GATCTCGGCAGCCTCGGAGCAGG + Intronic
931808808 2:65834271-65834293 GATCTCGGGAGGCAGGGCTCAGG - Intergenic
948247188 2:236496512-236496534 GTGCTCGGCAGGAACGTCGGAGG + Intronic
1171370265 20:24657978-24658000 GATCTCGGGAGGCAGGTGTCTGG + Intronic
1176243117 20:64084141-64084163 GAGCGCGCCAGGCACGGCGCAGG - Exonic
1182483919 22:30627892-30627914 GGCCTCGGCAGCCACGACGCAGG + Intergenic
1185009376 22:48304769-48304791 GTTCTCTACAGGCACGTCCCTGG - Intergenic
966449052 3:180037054-180037076 CCTCTCGGCAGGCACGCGGCTGG - Intergenic
987113821 5:14711522-14711544 GAGCTAGGCAGGCACTTCGGAGG + Intronic
987318277 5:16744547-16744569 GGTCTCAGCAGGCGCGGCGCAGG + Intronic
1001330599 5:170759853-170759875 GATCTCAGGAGGCAAGTCACGGG + Intergenic
1006797783 6:36742241-36742263 GGTCTCAGCAGGCAGGTGGCTGG - Exonic
1006797825 6:36742400-36742422 GATCTCTGCCAGCACGTCTCGGG + Exonic
1030151601 7:106411812-106411834 GATCTGGGCAGCCACGTGGGTGG + Intergenic
1049279184 8:141735644-141735666 AATCTCGCCAGGCCCGTCGCTGG - Intergenic
1057758311 9:97853907-97853929 GCTCTCGGCAGTCATGGCGCGGG - Exonic
1059389247 9:113988518-113988540 GATCTCGGCAGGCACGTCGCTGG - Exonic
1062626663 9:137446087-137446109 GAGCAGGGCAGGCAGGTCGCTGG + Intergenic
1185792272 X:2936535-2936557 GATCTCAGAAGGCATGTCGCTGG + Intronic
1189182417 X:39016770-39016792 GATCTCAGTAGCCACCTCGCAGG - Intergenic
1197863121 X:130991291-130991313 GAGCTTGGCAGGCAAGTAGCTGG + Intergenic
1201280962 Y:12341480-12341502 GATCTCAGAAGGCATGTCACTGG - Intergenic