ID: 1059389275

View in Genome Browser
Species Human (GRCh38)
Location 9:113988640-113988662
Sequence GCGCCAGGCCGCTTTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059389275_1059389277 -6 Left 1059389275 9:113988640-113988662 CCTGGGGAAAAGCGGCCTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1059389277 9:113988657-113988679 TGGCGCCTCTGCCCCCTTCCTGG 0: 1
1: 2
2: 1
3: 39
4: 322
1059389275_1059389284 13 Left 1059389275 9:113988640-113988662 CCTGGGGAAAAGCGGCCTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1059389284 9:113988676-113988698 CTGGCTGAGAGAACCTTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059389275 Original CRISPR GCGCCAGGCCGCTTTTCCCC AGG (reversed) Intronic