ID: 1059389277

View in Genome Browser
Species Human (GRCh38)
Location 9:113988657-113988679
Sequence TGGCGCCTCTGCCCCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 2, 2: 1, 3: 39, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059389269_1059389277 20 Left 1059389269 9:113988614-113988636 CCAGGGTGGGAACATGGAGTCAG 0: 1
1: 0
2: 1
3: 39
4: 239
Right 1059389277 9:113988657-113988679 TGGCGCCTCTGCCCCCTTCCTGG 0: 1
1: 2
2: 1
3: 39
4: 322
1059389275_1059389277 -6 Left 1059389275 9:113988640-113988662 CCTGGGGAAAAGCGGCCTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1059389277 9:113988657-113988679 TGGCGCCTCTGCCCCCTTCCTGG 0: 1
1: 2
2: 1
3: 39
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059389277 Original CRISPR TGGCGCCTCTGCCCCCTTCC TGG Intronic