ID: 1059389284

View in Genome Browser
Species Human (GRCh38)
Location 9:113988676-113988698
Sequence CTGGCTGAGAGAACCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059389278_1059389284 -9 Left 1059389278 9:113988662-113988684 CCTCTGCCCCCTTCCTGGCTGAG 0: 1
1: 1
2: 4
3: 72
4: 633
Right 1059389284 9:113988676-113988698 CTGGCTGAGAGAACCTTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 134
1059389275_1059389284 13 Left 1059389275 9:113988640-113988662 CCTGGGGAAAAGCGGCCTGGCGC 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1059389284 9:113988676-113988698 CTGGCTGAGAGAACCTTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 134
1059389276_1059389284 -2 Left 1059389276 9:113988655-113988677 CCTGGCGCCTCTGCCCCCTTCCT 0: 1
1: 1
2: 8
3: 68
4: 601
Right 1059389284 9:113988676-113988698 CTGGCTGAGAGAACCTTTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059389284 Original CRISPR CTGGCTGAGAGAACCTTTGC TGG Intronic