ID: 1059392303

View in Genome Browser
Species Human (GRCh38)
Location 9:114006888-114006910
Sequence CATGAGAGACACAGGTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059392303_1059392311 16 Left 1059392303 9:114006888-114006910 CCTGGTCACCTGTGTCTCTCATG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1059392311 9:114006927-114006949 AGCAGCCAGCAGGTGTGACCTGG No data
1059392303_1059392308 6 Left 1059392303 9:114006888-114006910 CCTGGTCACCTGTGTCTCTCATG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1059392308 9:114006917-114006939 CTCACAACCCAGCAGCCAGCAGG No data
1059392303_1059392313 26 Left 1059392303 9:114006888-114006910 CCTGGTCACCTGTGTCTCTCATG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059392303 Original CRISPR CATGAGAGACACAGGTGACC AGG (reversed) Intronic
900084630 1:886002-886024 CAGGAGAGACTGAGGTGACTAGG - Intergenic
901199423 1:7458189-7458211 CTGGAGGGACACAGGGGACCAGG - Intronic
902210311 1:14900081-14900103 CCTGGGATACACAGGTCACCAGG - Intronic
902511788 1:16970608-16970630 CAGGAGAGCCACAGGAGATCAGG - Intronic
902678930 1:18029520-18029542 GATGAGAGAGACAGGGGACTGGG - Intergenic
907290849 1:53411967-53411989 CAGCAGAGACACAGATGACCTGG + Intergenic
908398342 1:63746699-63746721 CCTGGGAGGCACAGGGGACCAGG + Intergenic
908759007 1:67494909-67494931 CACTAGCAACACAGGTGACCTGG - Intergenic
912649068 1:111422268-111422290 GGTGAGAGACACAGGGGACATGG - Intronic
912964395 1:114224744-114224766 CCTGAGAGACAGAGGTGCCCAGG - Intergenic
913094794 1:115506223-115506245 GAGGAAAGACACAGGTGCCCAGG + Intergenic
913332416 1:117678435-117678457 CATGAGAGACACTGGAGTGCTGG - Intergenic
919558688 1:199092988-199093010 CTTGAGAGAGTCAGGTGACAGGG - Intergenic
920802079 1:209198899-209198921 GATCAGAGACACAGGAGAGCAGG - Intergenic
923542773 1:234900577-234900599 CAGGAGAGAATCAGGGGACCAGG + Intergenic
1063972891 10:11393700-11393722 CATGAAAGACACAGAAGGCCGGG + Intergenic
1063979983 10:11445010-11445032 CAGGGGAGACGCGGGTGACCGGG - Intergenic
1065492348 10:26294487-26294509 CATAAAAGACACTAGTGACCAGG + Intronic
1067000510 10:42607360-42607382 AATGAGAGACACTGGAGACTTGG + Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1068866040 10:61896942-61896964 CAAGAGAGACACAGGGAACTCGG - Intergenic
1068936020 10:62636479-62636501 CATGAGAGCCATTGGTGAGCAGG - Intronic
1069629396 10:69888696-69888718 CATGGGAGACACAGGTGCTGGGG - Intronic
1072912555 10:99516609-99516631 CATAAGAGCTATAGGTGACCGGG + Intergenic
1073783594 10:106865066-106865088 TTGGAGAGACATAGGTGACCAGG + Intronic
1073896653 10:108168216-108168238 CATGAGAGCCACAGGGAGCCAGG + Intergenic
1075297550 10:121291615-121291637 CTTCAGAGCCACAGCTGACCGGG + Intergenic
1075533218 10:123248043-123248065 CATGAGATAGAAAGGTGAGCTGG + Intergenic
1075615561 10:123888801-123888823 CATTAGAAACACAGCTGACATGG + Intronic
1076202001 10:128566480-128566502 CATGTGATTCACAGGTCACCAGG - Intergenic
1077670753 11:4154967-4154989 CATGTGAGTCACAGGTGCCCAGG - Intergenic
1077747488 11:4923601-4923623 TATGAGAGACACAGGTGTTGAGG + Exonic
1078497039 11:11827815-11827837 CATTAAAGACACGGGTGGCCAGG - Intergenic
1079859673 11:25652372-25652394 AATGAGAGATACAGGTTAGCTGG - Intergenic
1080369941 11:31624992-31625014 TAAGATAGACTCAGGTGACCAGG - Intronic
1080512738 11:32991096-32991118 CATGAAAGAGACAGGTGATAAGG - Intronic
1080739109 11:35047351-35047373 CATGTGAGACTCAGGTGATGGGG + Intergenic
1081603172 11:44509474-44509496 CAAGAGAGAGACGGGTGATCAGG + Intergenic
1082110082 11:48264562-48264584 CATGAGAGGCACAGGTGGAGAGG - Exonic
1083185613 11:61016160-61016182 GATGAGAGACACAGTTGGCAGGG + Intronic
1083370567 11:62175772-62175794 CATGTGATACATTGGTGACCTGG + Intergenic
1083942317 11:65903064-65903086 CAAGTGTGACACAGGTAACCAGG + Intergenic
1084571800 11:69964275-69964297 AATGAGAGACACAGTTGGCAGGG + Intergenic
1084956961 11:72696714-72696736 CATGAGAGGCACAGCAGCCCAGG - Intronic
1085314740 11:75537794-75537816 CCTCAGAGACAGAGGAGACCAGG + Intergenic
1087336409 11:96850303-96850325 AATGAGAGACAGAGGAGAGCAGG + Intergenic
1088623876 11:111714482-111714504 CAGGGGAGAAACTGGTGACCAGG + Intronic
1092897990 12:13032181-13032203 CATGAGAGAAAAAGGTGTCAGGG - Intergenic
1093099918 12:15015377-15015399 CCAGAAAGACAAAGGTGACCTGG + Intergenic
1094191423 12:27702010-27702032 GATGAGAGAAAAAGGTGGCCTGG + Intergenic
1094255072 12:28414572-28414594 CATGTGACACACAGGAGACCAGG - Intronic
1098150353 12:67540036-67540058 CAGGAAAGAGACAGGAGACCAGG + Intergenic
1099397770 12:82162407-82162429 AATGAGAGAATCAGGTGACAGGG - Intergenic
1103294923 12:119877656-119877678 CATGAGAGAGAAAGAAGACCAGG - Intergenic
1104016259 12:124964452-124964474 CCTGGGAGACCCAGGTGACACGG + Exonic
1104368897 12:128204572-128204594 CCTGACAGCCACAGGTGGCCAGG - Intergenic
1104455094 12:128904576-128904598 CATGTGAGTCACTGGTGTCCAGG + Intronic
1106352087 13:28940792-28940814 CATGAGAGACACATGGGACATGG + Intronic
1106402145 13:29441297-29441319 CATGGGAGCCATATGTGACCTGG + Intronic
1110740030 13:78984146-78984168 CATGGGAGACACATGTATCCTGG + Intergenic
1113066362 13:106377094-106377116 CAGGGGAGACACATGTGACACGG - Intergenic
1113364477 13:109663429-109663451 CAGCAGAGACTCATGTGACCTGG - Intergenic
1113752105 13:112783611-112783633 CATGAGAAACACAGCTGAAGAGG - Intronic
1113786972 13:113007032-113007054 TCTGAGAGACACAGGAGGCCGGG - Intronic
1114183799 14:20385181-20385203 CATCAGAGATACAGGAGTCCTGG - Intronic
1115203286 14:30875276-30875298 CATGGGAGAAACAGGTGAGCAGG - Intronic
1115983540 14:39080154-39080176 CATGAGAGATACAGTTCACGGGG - Intronic
1119229588 14:72969734-72969756 CATGACAGACAGAGATGTCCAGG + Exonic
1121111207 14:91314294-91314316 CTTGACAGACACAGGTGAGTGGG + Intronic
1121155063 14:91675438-91675460 CAGAAGAGACAGAGGAGACCTGG - Intronic
1121585117 14:95058068-95058090 CATGAGAGACACCTGTGGCTGGG - Intergenic
1122932476 14:104940690-104940712 CCTGAGACACACAGGTGCCTGGG + Exonic
1124552778 15:30696788-30696810 AGTGAGAGATACAGGTGGCCTGG - Intronic
1124678464 15:31708882-31708904 AGTGAGAGATACAGGTGGCCTGG + Intronic
1125013241 15:34903443-34903465 TATGAGAGATAAAGGTGTCCTGG + Intronic
1126025396 15:44441479-44441501 CCTGAGAGACACAGATAACAAGG - Intronic
1126303745 15:47230583-47230605 CATTGGAGTCACAGGTCACCAGG + Intronic
1126459815 15:48903039-48903061 CATAAGAGACACAGATGATCTGG + Intronic
1129522452 15:76194448-76194470 CCTGAGGGACACAGGGAACCAGG - Intronic
1130926876 15:88392103-88392125 CATGGCAGACACAGGGCACCAGG - Intergenic
1132401805 15:101513901-101513923 CAGGAGAGTCACATGAGACCAGG + Intronic
1134192627 16:12134368-12134390 CATGAGAGACCCTGATGCCCTGG - Intronic
1134450147 16:14358335-14358357 CAGGAGGGAGGCAGGTGACCTGG + Intergenic
1135380798 16:21994767-21994789 CTTAGGAGAAACAGGTGACCTGG + Intronic
1136520686 16:30793877-30793899 CATGTGAGCCACAGGTGTGCTGG + Intergenic
1137608413 16:49802386-49802408 CATGAGAGACAATGGTGTGCTGG + Intronic
1138347840 16:56330950-56330972 CAGGGGACACACAGGTGGCCAGG + Intronic
1140182612 16:72735860-72735882 CAGGAGAGACCCAGGTGAAAAGG - Intergenic
1141519415 16:84567779-84567801 AATGAGGGAACCAGGTGACCTGG + Intronic
1143920065 17:10324072-10324094 CAAGAGAGACATTGATGACCTGG - Exonic
1146071018 17:29681422-29681444 CTTGAGAGACTGAGGTAACCTGG - Intronic
1146076139 17:29731181-29731203 CATGGAATAGACAGGTGACCTGG + Intronic
1146510142 17:33439908-33439930 CATGCAAGTCAAAGGTGACCTGG + Intronic
1146705599 17:34998669-34998691 CATGGCCGACACAGCTGACCTGG + Exonic
1147129616 17:38399357-38399379 CATGAGGGCCACATGTGACTAGG - Intronic
1147163406 17:38580411-38580433 CATGAGAGCCGCAGCTCACCAGG + Intronic
1147645003 17:42028130-42028152 CAAGAGAGTCACAGGGGGCCGGG - Exonic
1148213710 17:45823241-45823263 CATGAAAGACACAGATTCCCAGG - Intronic
1149018295 17:51934086-51934108 AATGAGGGACACAGCTGAGCAGG - Intronic
1150325446 17:64252996-64253018 CAGGAGAGACACAGAGGCCCAGG + Intronic
1150435834 17:65153487-65153509 CATGAGGAACGCTGGTGACCAGG - Exonic
1151318011 17:73335763-73335785 CCTGTGAGGCACAGGTGGCCTGG - Exonic
1151537977 17:74749336-74749358 CCGGAGAGACCCAGGTGCCCCGG + Intronic
1153135283 18:1910929-1910951 CATGAGTGACACAGAAGACGGGG + Intergenic
1154185765 18:12181691-12181713 CATGAGCGACACAGAAGACGGGG + Intergenic
1155525477 18:26712233-26712255 CATGAGAAATACAGGTTACTAGG + Intergenic
1156294102 18:35774362-35774384 CATCAGAGAGAGAGTTGACCAGG - Intergenic
1156838524 18:41584224-41584246 AAAGAGAGACACAGATGCCCAGG + Intergenic
1157079145 18:44502957-44502979 CATCAGAGAAAGAGGTGACAGGG - Intergenic
1157733852 18:50029263-50029285 AACGAGAGACCCAGGTGAGCAGG + Intronic
1158269616 18:55698415-55698437 CAAGTGAGACACAGGTTACTGGG + Intergenic
1159688090 18:71448735-71448757 AAGGAGAGACACAGCTAACCTGG - Intergenic
1160183870 18:76659831-76659853 CCTGGGAGACACAGCTGCCCAGG + Intergenic
1160737702 19:671640-671662 CATGGGAGGCACAGGGGTCCTGG + Intergenic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1164389436 19:27805357-27805379 CATGTGAGACAAGGGTGGCCGGG + Intergenic
1164605073 19:29592026-29592048 CCAGAGAGACAGAGGTGACAAGG + Intergenic
1165114212 19:33519362-33519384 CATGAGAGTTCCAGGTGACTGGG - Intronic
1165158238 19:33801198-33801220 CAGGGGAGACACAGGCGACCGGG - Exonic
1165819112 19:38663366-38663388 TATGAGAGAAACCGGAGACCTGG + Intronic
1167300222 19:48673608-48673630 CATGAGAAACACTGGGGCCCAGG - Intergenic
925401698 2:3578078-3578100 CATGCTAGACACAGTTGACATGG + Intronic
925742649 2:7019395-7019417 CATGTGTGACACAGGCGAGCGGG + Intronic
925985050 2:9207849-9207871 CAGGTGAGACCCAGGTAACCGGG - Intronic
926174993 2:10582949-10582971 CAATAGAGACACAAGTGACTGGG - Intronic
927807196 2:26158698-26158720 CTTTAGAGAAACAGGTGGCCGGG + Intergenic
928900097 2:36308425-36308447 CAGGAGAGACCCAGGTGAATAGG + Intergenic
930768132 2:55105742-55105764 CAGGAGAAACACTTGTGACCAGG + Intronic
931443632 2:62308563-62308585 CATGGTAGGTACAGGTGACCCGG - Intergenic
931873996 2:66492209-66492231 GATGAGACAGACAGCTGACCAGG + Intronic
935155853 2:100482860-100482882 CATGAGAAACAGAGGAGGCCCGG - Intronic
939022862 2:136980061-136980083 CAGGAGAGACCCAGGTGAATAGG - Intronic
942459175 2:176157868-176157890 CCTGGTAGACACAGGCGACCAGG - Intronic
942756865 2:179351485-179351507 GCTGAGAGACAGAGGTGGCCAGG + Intergenic
943420127 2:187659191-187659213 AATGAGACAGACAGGTGGCCAGG + Intergenic
943446802 2:187996172-187996194 CAGCAGAGACACAGGTGTGCTGG + Intergenic
948080808 2:235203698-235203720 CATGTGGGACACAGGTGACATGG + Intergenic
948151666 2:235749484-235749506 CCTCAGGGTCACAGGTGACCTGG - Intronic
948589348 2:239039338-239039360 CAAGAGACACAGAGGTGGCCGGG - Intergenic
948980683 2:241493093-241493115 CAAAAGGGACACAGGTGAGCAGG - Exonic
1169970667 20:11266316-11266338 AATGTGGGACACAGGTGCCCCGG - Intergenic
1170959519 20:21012784-21012806 CTTGAGAGTCATAGGTGTCCTGG + Intergenic
1171774847 20:29355514-29355536 CAGGAGAGACTGAGGTGACTAGG + Intergenic
1171816856 20:29793144-29793166 CAGGAGAGACTGAGGTGACTAGG + Intergenic
1171901490 20:30862833-30862855 CAGGAGAGACTGAGGTGACTAGG - Intergenic
1173295101 20:41748954-41748976 CCTGGGAGACCCAGGGGACCAGG - Intergenic
1174080909 20:47970221-47970243 TCTGAGAGACACAGGAGAGCGGG - Intergenic
1174608045 20:51775317-51775339 GATGAAAGACACAGGGAACCTGG - Intergenic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1177655518 21:24011426-24011448 CATGAGAGAGAGAGATGAGCTGG - Intergenic
1177775759 21:25564011-25564033 CTGGAGAGACAAAGGTGAGCAGG + Intergenic
1178242858 21:30922605-30922627 GATGAGACAAACAGGTGACTAGG + Intergenic
1179063596 21:38003500-38003522 CATGAGAGCCACTGGAGACATGG - Intronic
1179114270 21:38475671-38475693 CATGATAGAGCCAGGTGGCCGGG - Intronic
1179284347 21:39963924-39963946 TATGAGTTACTCAGGTGACCAGG - Intergenic
1182550148 22:31096599-31096621 CATGAATGACACAGGTAACAAGG - Intronic
1182710377 22:32318961-32318983 GATGAGAGGAACATGTGACCTGG + Intergenic
1182755532 22:32675927-32675949 CATGAGGACCACAGGTGAACTGG + Intronic
950131868 3:10552781-10552803 CATGTGAGAAGCAGGTGAACTGG + Intronic
952684372 3:36131981-36132003 CCCTAGAGACACAGGTCACCAGG + Intergenic
954379126 3:50210336-50210358 CAGGAGAGAGACAGCTGGCCTGG - Intronic
960908231 3:122622800-122622822 CATGAGAGTGACAGGGGACATGG - Intronic
961531392 3:127542425-127542447 CATGAGGGACACATGCAACCTGG + Intergenic
961542765 3:127611269-127611291 CATGTGGGACACAGGTGGCCCGG - Intronic
963251791 3:143110593-143110615 AATGAAAGTCACAGGTGAACTGG + Intergenic
963416172 3:144998719-144998741 CAGGAGAGACCCAGGTGAATAGG - Intergenic
963610170 3:147457202-147457224 CATGAAAGACACAAGAGACATGG + Intronic
964824342 3:160808893-160808915 GAGGAGAGGGACAGGTGACCAGG - Intronic
967757644 3:193188145-193188167 CCTGAGACACACAGATGACCAGG + Intergenic
968193802 3:196690501-196690523 CAGGAGAAACACAGGTGTCCAGG + Intronic
968358933 3:198133196-198133218 CAGGAGAGACTGAGGTGACCAGG - Intergenic
968762277 4:2448920-2448942 TGTGAGAGACAGAGGTGACAAGG + Intronic
969321197 4:6413894-6413916 AAAGAGAGACACGGGTGAGCAGG - Intronic
969796341 4:9531174-9531196 CAGGAGAGACAGGGGAGACCGGG - Intergenic
973945499 4:55950184-55950206 AAGGAGAGACTCAGGAGACCTGG + Intronic
974553815 4:63417306-63417328 AATGAGAGAGAAAAGTGACCAGG + Intergenic
976527776 4:86114474-86114496 CAGGAGGGACCCAGGTGAACTGG - Intronic
976922121 4:90454011-90454033 CCCCAGAGACACAGGTCACCAGG - Intronic
978069712 4:104452329-104452351 CATCAGAGAGACAGGGGGCCTGG + Intergenic
979181349 4:117731920-117731942 CCTGAGTGACAGAGGTTACCTGG - Intergenic
982145291 4:152381977-152381999 AATGAGAGAAAAAGGTGAACTGG + Intronic
982958710 4:161807397-161807419 TATGGGAGATACAGTTGACCTGG + Intronic
995512620 5:112923571-112923593 CATCAGGGTCACAGGTGACATGG + Intergenic
995983836 5:118143719-118143741 CATGAGAGATAATGGTGCCCTGG - Intergenic
996669809 5:126104163-126104185 CAGGAGACAGGCAGGTGACCTGG - Intergenic
997393862 5:133540685-133540707 CATGAGAGGGAGAGGTGAGCTGG - Intronic
997481220 5:134186037-134186059 GATGAGAGAAACAGGTGTCAAGG + Intronic
998018688 5:138752922-138752944 CAAGAGTGTCACAGGTGTCCCGG - Intronic
1000291722 5:159877215-159877237 GAGGGGAGACACAGGGGACCGGG - Intergenic
1006105659 6:31714638-31714660 TAGGGGAGACACAGGTGCCCAGG + Intronic
1007278924 6:40695927-40695949 TGTGAGGGACACAGGTGACTTGG + Intergenic
1011890762 6:92156561-92156583 CATTAGAGACACATATGATCTGG + Intergenic
1013681115 6:112527419-112527441 AATGAGACACATGGGTGACCCGG - Intergenic
1015185322 6:130408998-130409020 CATGTGAGACAGAGCTGGCCTGG - Intronic
1016534267 6:145092944-145092966 CATCAGAGTCACAGGAGAGCAGG - Intergenic
1017075360 6:150612730-150612752 TATGAGAAACAAATGTGACCAGG - Intronic
1017488424 6:154923488-154923510 CAGGGGAGACCCAGGTTACCTGG - Intronic
1018742793 6:166743465-166743487 CATGAAAGACACAGTTGGGCAGG + Intronic
1018837368 6:167495009-167495031 CATGGGAAACAGAGGTGACTGGG + Intergenic
1018927921 6:168219629-168219651 CAAGAGGGACCCAGGTGACATGG + Intergenic
1019103273 6:169649436-169649458 CATGAGAGACACAGGAGGGGAGG - Intronic
1020377878 7:7508464-7508486 CATGAGAGACAAAGGACAGCCGG - Intronic
1024795233 7:53012304-53012326 TAGGAGAGACCCAGGTGAACAGG - Intergenic
1025066219 7:55857880-55857902 CAAAAAAGACACAGGTGGCCGGG - Intronic
1026850153 7:73719030-73719052 GATGGGAGCCACAGGTGACCAGG + Intronic
1028280538 7:88921311-88921333 CTTGAGAGACACAGGTGAATAGG + Intronic
1028546415 7:92006953-92006975 CATTAGAGATACAGGAGACTGGG - Intronic
1029850219 7:103453902-103453924 CATGAGCGACACAGAAGACGGGG - Intergenic
1029933995 7:104403353-104403375 CAGGAGAGACACAAGTAAACAGG - Intronic
1035216372 7:157370701-157370723 CATGGGAAACACAGGGTACCTGG - Intronic
1040284360 8:46092363-46092385 CATGAGAGACACAGTCGTCCTGG - Intergenic
1040284553 8:46093222-46093244 CACGAGAGACACAGGCACCCTGG - Intergenic
1040285417 8:46098186-46098208 CATGAGAGATACAGGCATCCAGG - Intergenic
1040296419 8:46151399-46151421 CACGAGAGACACAGGCACCCTGG + Intergenic
1040296674 8:46152479-46152501 CATGAGAGACACAGTCACCCTGG + Intergenic
1040306120 8:46212727-46212749 CGTGAGAGACACAGGCACCCTGG - Intergenic
1040319419 8:46285187-46285209 CTTGAGAGACACAGGCAACTTGG + Intergenic
1041256021 8:55980180-55980202 GATGAGAGACAATGGTGACCTGG - Intronic
1044306997 8:90649500-90649522 CAAGGGAGACACAGGAGGCCTGG - Intronic
1046707775 8:117475612-117475634 CATGAAAGAGGCAGGTGAACAGG - Intergenic
1047489738 8:125364706-125364728 CATGATAGTCACAGGGGATCTGG + Intronic
1047712210 8:127563885-127563907 CAGGAGAGATGCAGGTAACCTGG + Intergenic
1048556719 8:135484990-135485012 CATCAGAAACGCAGTTGACCAGG + Intronic
1049081603 8:140447592-140447614 CATGAGGGGCACATGTGAGCTGG + Intronic
1049678146 8:143902627-143902649 CAGGAGTGAGACAGGTGGCCGGG + Intergenic
1049802354 8:144523806-144523828 AAGGAGAGAGACAGCTGACCAGG - Exonic
1049807098 8:144546051-144546073 GATGGGTGACCCAGGTGACCTGG + Intronic
1051707173 9:19892935-19892957 CATGAGAGGGACAAGTGACCAGG + Intergenic
1052396501 9:27944833-27944855 CATGTGAGATATAGGTGACTGGG + Intergenic
1055697271 9:78899631-78899653 CATGAGAGAGAAAGGGGAGCTGG - Intergenic
1056945346 9:90990442-90990464 GCTGAGAGACACAGGTTACCTGG - Intergenic
1059392303 9:114006888-114006910 CATGAGAGACACAGGTGACCAGG - Intronic
1059712211 9:116878992-116879014 CCTGAGAGACTCTGGTGATCTGG + Intronic
1059936986 9:119321362-119321384 CTTGATAGACACATGTGACCAGG - Intronic
1060045025 9:120333091-120333113 CATCAGAGACACCTGTGACTGGG - Intergenic
1060735544 9:126064491-126064513 CATGAGAGTCCCAGGTAAGCAGG - Intergenic
1060736874 9:126071605-126071627 CATGAGAGAAGCCGGTGGCCTGG - Intergenic
1061037581 9:128122185-128122207 CAGGAGAGAAACAGATGACCAGG - Intronic
1061287849 9:129634328-129634350 CAGGAGACATACAGGTGAGCAGG - Intronic
1061676269 9:132217657-132217679 CATGAGACAAACAGGTGCCTAGG - Intronic
1185806955 X:3066738-3066760 CATGGGAGAGAGAGGTGACACGG + Intronic
1186139002 X:6550971-6550993 TGTGGGATACACAGGTGACCTGG + Intergenic
1188695357 X:33183658-33183680 GATGAAAGCCACAGGTGACTTGG - Intronic
1189889127 X:45580798-45580820 CATGCCAGATACAGGTGTCCTGG - Intergenic
1190702734 X:53000254-53000276 CATCAGCGACAGAGGTGACAGGG + Intergenic
1192734949 X:73842063-73842085 AATGAGAGACACTGGTCACCAGG + Intergenic
1193530423 X:82648719-82648741 CCTGGGAGACAGAGGTCACCAGG - Intergenic
1193874021 X:86837951-86837973 CATGAGTGACACAGGTCTCAGGG + Intergenic
1198799751 X:140436760-140436782 AAGGAGAGACAAAGGGGACCAGG + Intergenic
1199134354 X:144233227-144233249 AATGAGAGACAGAGTTGAGCGGG - Intergenic
1200079277 X:153567588-153567610 CACGAGACACACAGGTGGCCGGG - Intronic
1200321654 X:155196370-155196392 CAGGAGGGACCCAGGTGACTAGG - Intergenic
1201488406 Y:14514697-14514719 CATGTTTGACACAGTTGACCTGG + Intergenic
1201530553 Y:14986180-14986202 CATGAGAGAGTCAGGTGACAAGG - Intergenic