ID: 1059392307

View in Genome Browser
Species Human (GRCh38)
Location 9:114006896-114006918
Sequence AGCTGCCCCATGAGAGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059392307_1059392311 8 Left 1059392307 9:114006896-114006918 CCTGTGTCTCTCATGGGGCAGCT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1059392311 9:114006927-114006949 AGCAGCCAGCAGGTGTGACCTGG No data
1059392307_1059392308 -2 Left 1059392307 9:114006896-114006918 CCTGTGTCTCTCATGGGGCAGCT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1059392308 9:114006917-114006939 CTCACAACCCAGCAGCCAGCAGG No data
1059392307_1059392313 18 Left 1059392307 9:114006896-114006918 CCTGTGTCTCTCATGGGGCAGCT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059392307 Original CRISPR AGCTGCCCCATGAGAGACAC AGG (reversed) Intronic
900823706 1:4909781-4909803 TGCAGCTCCATGAGAGCCACTGG + Intergenic
901016027 1:6231317-6231339 AGCTGCCACATGAGTGACAGAGG + Intronic
901513990 1:9733057-9733079 AGATTTCCCATGAGAGAAACAGG - Intronic
901916969 1:12507282-12507304 AGCTGGCCCATGGGTGACCCTGG + Intronic
902373749 1:16020534-16020556 AGCTGCCCCAGACCAGACACTGG + Intronic
902378670 1:16042369-16042391 AGCTGCCCCAGACCAGACACTGG + Intergenic
903643343 1:24875391-24875413 GGCTGCCCCATGAGAGAAGTGGG - Intergenic
904297106 1:29526950-29526972 AGCTTCAACATAAGAGACACTGG - Intergenic
905647875 1:39637134-39637156 ACCTGCCACATGTCAGACACTGG - Intronic
907198002 1:52703032-52703054 AGCCGCCCCGTGAGAGAGACCGG + Intergenic
909124548 1:71649830-71649852 AGCTCACACATAAGAGACACAGG - Intronic
913553570 1:119940568-119940590 AGCTGCCCCCTGGGCTACACTGG - Exonic
914377064 1:147080760-147080782 CTCTTACCCATGAGAGACACCGG + Intergenic
916843572 1:168625660-168625682 AGATTGCCCATGAGAGCCACTGG + Intergenic
918999868 1:191816634-191816656 AGTTGCCCCTTGAGCAACACTGG + Intergenic
922786799 1:228286920-228286942 AGCTGAGCCATGAGGGCCACCGG + Exonic
1063577873 10:7278363-7278385 AGCTGCTCCATGAGAGCGAGAGG + Intronic
1065628425 10:27654051-27654073 AGCTGCCCCTTGAGAGGCAGAGG + Intergenic
1066504093 10:36024022-36024044 TGCTGCTTCATGAGAGACATAGG + Intergenic
1068927422 10:62554696-62554718 AGGTGCCCCACGAGACAGACTGG - Intronic
1070647740 10:78213133-78213155 AGCCACCACATGAGAGACCCAGG - Intergenic
1070665711 10:78342045-78342067 AGCAGCCCCTTGTGAGACATGGG - Intergenic
1074898054 10:117794023-117794045 GGCTGCCCCACGACAGACAATGG + Intergenic
1075779579 10:125008358-125008380 GGCTGCCCAAGGACAGACACTGG + Intronic
1077734013 11:4769171-4769193 TGCTCCCACATGGGAGACACAGG + Exonic
1078132127 11:8621530-8621552 TGCAGCCCCATCAGAGACTCAGG + Intronic
1078570187 11:12451168-12451190 AACTGCCCCATGAGAGGATCTGG + Intronic
1081909408 11:46691182-46691204 ACCTGCCACATGCCAGACACTGG - Intronic
1081977292 11:47243772-47243794 AGCTGCCCCAAGAGAACCACTGG - Intronic
1081991403 11:47339520-47339542 GGCTACCCCATGGGAGAGACTGG - Intronic
1082808473 11:57464352-57464374 CGCTGCCCCAGGAGAGACAGAGG - Intronic
1083373736 11:62203005-62203027 AGCTGCCCACGGAGAGCCACAGG + Intergenic
1083379259 11:62251672-62251694 AGCTGCCCACAGAGAGCCACAGG + Intergenic
1083545399 11:63545562-63545584 AGGTGCCCCATTAGAGGCCCAGG + Intronic
1083776677 11:64897543-64897565 AGCTAGCCCATGGGAGCCACTGG + Intronic
1085515354 11:77108365-77108387 AGCTGGCCCCTAAGAGACAAGGG + Intronic
1087134102 11:94696823-94696845 ATGTTCCACATGAGAGACACTGG + Intergenic
1087606371 11:100383539-100383561 AGCTCGCCCAAGAGTGACACAGG + Intergenic
1088819773 11:113447313-113447335 AGCTCCCCCAGGAAAGGCACAGG - Intronic
1089019835 11:115201730-115201752 AGCTAGCCCATGAGAAAAACAGG + Intronic
1090556675 11:127883759-127883781 AGTTGGCCAATGAGAGACTCTGG - Intergenic
1092263915 12:6967134-6967156 GGCAGCCCCATCAGAGACGCTGG + Intronic
1099747008 12:86718398-86718420 TGCTGCTGCATGAAAGACACAGG - Intronic
1100800381 12:98224529-98224551 AGCAGCCCCAAGAGAGAATCAGG + Intergenic
1100877037 12:98973367-98973389 ACCTGCCCCAAGAAAGATACAGG - Intronic
1101521091 12:105483099-105483121 AGCTGCCCCAGGAGAGAGGAGGG + Intergenic
1101808822 12:108090504-108090526 AGCTCCCCCTTAAGAGACAGTGG + Intergenic
1103937800 12:124485779-124485801 AGCTGCCCCATCTGAGAAATAGG + Intronic
1104043040 12:125142948-125142970 GGCTCACCCATGAGGGACACGGG - Exonic
1104569845 12:129915643-129915665 AGCTTCCCCATAAGTGAAACGGG - Intergenic
1104607235 12:130199077-130199099 AGCTGCCTCGTGAGAGACGAAGG + Intergenic
1106346827 13:28887377-28887399 AGCTGCCCCATCATTGACTCAGG + Intronic
1106926020 13:34614038-34614060 TGTTGCCCCATGAGTGACAAAGG - Intergenic
1107861109 13:44661540-44661562 AGCGGCCACATGAGTGACAGAGG - Intergenic
1111795461 13:92913521-92913543 AGCTGCCCCACCAGCAACACTGG - Intergenic
1113098422 13:106690871-106690893 AGCTGCCCCGTCAGAGCCATGGG - Intergenic
1115642339 14:35342554-35342576 AGCTGCCCCAACAGTGAGACGGG - Intergenic
1116065170 14:39972936-39972958 GGCTGTCCCAAGAGATACACAGG + Intergenic
1118230129 14:63939800-63939822 AGCTACCCCATAACAGAAACAGG + Intronic
1126748053 15:51846994-51847016 AGCTGCAGCATCAGAGACACAGG - Intronic
1129330725 15:74825995-74826017 AGCTGGGCCAGGAGGGACACTGG - Intergenic
1130654514 15:85782697-85782719 TGGTGCCCCATGCGACACACAGG + Intronic
1130877741 15:88028944-88028966 AGCTGCCACATGGGTGACAAAGG + Intronic
1131068564 15:89449540-89449562 AGCGCCCCCAGGAGAGAGACAGG + Intergenic
1133128238 16:3660577-3660599 AGCTGCTCCAGCAGAGGCACAGG + Exonic
1134742516 16:16560412-16560434 AGCTTCCCCATGTGAGAAATGGG - Intergenic
1136237136 16:28921518-28921540 AGGCGCCCAAGGAGAGACACTGG + Intronic
1137621638 16:49880244-49880266 AGCTGCCAGATGAGAGACGATGG + Intergenic
1138345201 16:56316318-56316340 GGCTGCCCCAGGATGGACACTGG + Intronic
1142150191 16:88509298-88509320 AGCTGGCCTATGGGAGCCACAGG + Intronic
1142912946 17:3111484-3111506 AGTTGCCCCATGAACAACACAGG + Intergenic
1145036055 17:19541365-19541387 GGCTTCCCCAAGAGAGATACTGG + Intronic
1145038403 17:19557596-19557618 AGCTGGCCCATGGGTGACCCTGG + Intronic
1145761240 17:27426355-27426377 ACCTTCCCCATGAGAGTCACCGG - Intergenic
1146678774 17:34792196-34792218 AGTTTCCCCATGAGTGAAACAGG + Intergenic
1147201185 17:38802657-38802679 ACCTTCCCCATGAAAGACCCTGG + Intronic
1147618442 17:41845424-41845446 GGCTGCCCCATGGTAGGCACGGG - Exonic
1147872896 17:43600152-43600174 AGCTGAGCCAAGAGAGACAGGGG - Intergenic
1151171227 17:72247876-72247898 AGCTGCCCCATGAGGGAGGAAGG + Intergenic
1152725148 17:81941483-81941505 AGTTGCCCCAGGAGAGCCGCAGG + Exonic
1153176551 18:2380238-2380260 AGCTGCCTCAAGAGAGAGAAAGG + Intergenic
1158461919 18:57653999-57654021 AGCAGCCCCATGAGGAGCACGGG + Exonic
1158544238 18:58382186-58382208 AGAAGCCGCATGAGAGACCCAGG + Intronic
1160265748 18:77339778-77339800 GGCTCCCTCAGGAGAGACACAGG - Intergenic
1160520683 18:79506322-79506344 AGCTTCCCCAGCAAAGACACTGG + Intronic
1160665743 19:327350-327372 AGCAGCCCCATGTGAGCCTCAGG - Intronic
1161148591 19:2694771-2694793 ATCTGCTCCCTGAGGGACACTGG + Intronic
1161171880 19:2816215-2816237 AGATGCCCCATCTGGGACACGGG - Intergenic
1161230549 19:3172820-3172842 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161230784 19:3173857-3173879 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161230801 19:3173934-3173956 AGGTGTCCCATGAGAGGCACAGG - Intronic
1161231038 19:3174989-3175011 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161231071 19:3175124-3175146 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161231088 19:3175201-3175223 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161231105 19:3175278-3175300 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161231131 19:3175394-3175416 AGGTGTCCCATGAGGGGCACAGG - Intronic
1161462137 19:4403708-4403730 ATCTGCCCCATAGGGGACACAGG - Intronic
1162724181 19:12680005-12680027 AGCTCCCTCATAAGAGTCACTGG - Intronic
1164775883 19:30853194-30853216 AGCTGACCCTTGAAAGACAAAGG - Intergenic
1164878048 19:31706669-31706691 AACTGCCCCATGCTGGACACAGG + Intergenic
1167300226 19:48673616-48673638 CTCTGCCGCATGAGAAACACTGG - Intergenic
925417431 2:3680395-3680417 AGCTCCCCCATCACACACACTGG - Intronic
925487517 2:4352282-4352304 AGCTGCCACATGAGATGCCCTGG + Intergenic
926753305 2:16216822-16216844 GGCTGCCCCATCAGAGACGACGG + Intergenic
929427520 2:41858317-41858339 AGTTGACCCTTGAGAAACACAGG - Intergenic
934560201 2:95309248-95309270 AGCTGGCCCATGAGGCACAGAGG - Intronic
937863502 2:126731447-126731469 AGCTGGCCCATGGCAGACAGGGG - Intergenic
938144557 2:128822638-128822660 AACTGGCCCTTGAGACACACCGG + Intergenic
939040157 2:137178999-137179021 AGCACTCCTATGAGAGACACAGG - Intronic
939166643 2:138647643-138647665 CACTGCCCTATGAGAGACTCTGG - Intergenic
941864276 2:170317701-170317723 AGCTGCCTCATGGGAAGCACAGG - Intronic
945891081 2:215432078-215432100 AGCTTTCCCATCAGAGACAGGGG + Intronic
946631469 2:221673954-221673976 CCCTGCCCCATGTGAGACATTGG + Intergenic
947533671 2:230927992-230928014 AGCTGAACCCTAAGAGACACGGG + Intronic
949050571 2:241895458-241895480 AGCTGGCCCATGTGGGAGACCGG - Intronic
1169070665 20:2727560-2727582 AGCTGACCCTTGAAAAACACAGG - Intronic
1171127991 20:22621330-22621352 AACTGCTCCCTGAGAAACACTGG + Intergenic
1171146350 20:22786822-22786844 AGTTGCCCCATCTGAGACAAAGG - Intergenic
1172516864 20:35541243-35541265 AGCTGTCCCTCTAGAGACACTGG + Intergenic
1172637025 20:36416852-36416874 AGCTGCCCGATGGGAGAGAAGGG - Intronic
1174691921 20:52514964-52514986 AGATGTCCTATGAGAGGCACAGG - Intergenic
1180247765 21:46559742-46559764 AGCAGCCACATGAGAAACACAGG - Intronic
1181203366 22:21232343-21232365 TGCTGCCTCCAGAGAGACACAGG + Intergenic
1181407200 22:22693386-22693408 AGCTTCCCCAGGAGAGAGTCCGG - Intergenic
1181415187 22:22754153-22754175 AGCTTCCCCAGGAGAGAGTCGGG - Intronic
1181439243 22:22927293-22927315 TGCTGCCCCATCAGGGCCACCGG + Intergenic
1183316810 22:37141528-37141550 AGCTGCCCCAGGAGAGCTCCTGG - Intronic
1184244801 22:43230516-43230538 AGCTGCCCCCTGAAAGAGGCAGG - Intronic
949616675 3:5761080-5761102 ACCTGGCCCATCATAGACACTGG - Intergenic
950114962 3:10444784-10444806 ATCTGCTCCATGGGTGACACAGG + Intronic
950503084 3:13376683-13376705 AGCTGCCCCAGGTGCCACACGGG - Intronic
952888831 3:38028068-38028090 GGCTGCCTCAGGAGAGAAACTGG + Intronic
953432280 3:42850117-42850139 AGCTGCCCAACAAGAGCCACAGG - Intronic
956752203 3:72352332-72352354 AGGTGCCCCAAGAGAGAGATGGG - Intergenic
958573724 3:95920482-95920504 ACCTGGCCCATCAGAGTCACAGG + Intergenic
959151744 3:102616378-102616400 GGCTGCTCCATTACAGACACAGG - Intergenic
960796078 3:121489749-121489771 AGCAGCCCCCTGAAAGACTCTGG - Exonic
961012067 3:123443082-123443104 GGCTGCCCCATGTGAGACGCTGG - Intronic
961434844 3:126909825-126909847 TGCTGCCCACTGAGAGACACTGG - Intronic
961696468 3:128708840-128708862 AGGTGCCCTATGTGAGACTCTGG - Intergenic
961769153 3:129235892-129235914 TGCTGCCTCATGAGAGACCCTGG + Intergenic
961781677 3:129324228-129324250 AGCTGCCCCAGGTGCCACACGGG - Intergenic
962316503 3:134362793-134362815 ACCTGCCCCTTGAGAGTCCCAGG + Intronic
962646912 3:137449112-137449134 ATCTGCTCCATTAGAAACACAGG + Intergenic
963926566 3:150957482-150957504 AGATGTCAAATGAGAGACACTGG - Intronic
964441728 3:156718267-156718289 AGCTGACTCTTGAAAGACACAGG - Intergenic
967979889 3:195059431-195059453 AGGTGCCCCAGCAGAGCCACAGG + Intergenic
968599917 4:1503930-1503952 AGCTGCCCCAGGCTGGACACTGG - Intergenic
969083217 4:4636267-4636289 ATCTGCCACATGACAGGCACTGG + Intergenic
969433354 4:7168955-7168977 ATCTGCCCCAAGACAGACACAGG - Intergenic
969842545 4:9893157-9893179 AGCTGGACCAGGTGAGACACTGG - Intronic
970662734 4:18304544-18304566 AACAACCACATGAGAGACACAGG - Intergenic
973339804 4:48992606-48992628 AGCTGGCCCCTGGGAGAGACAGG - Intronic
975258855 4:72272405-72272427 AGCAACCACCTGAGAGACACGGG + Intergenic
976083164 4:81379070-81379092 AGCTGACCCTTGAACGACACAGG - Intergenic
978669775 4:111232729-111232751 AGCTGCACCATCAAAGAAACTGG - Intergenic
979711344 4:123783520-123783542 AGCTGTCAGATGAGAAACACAGG + Intergenic
984925832 4:184805881-184805903 AGCTTCCCAATAAGAGACAACGG + Intronic
985040486 4:185886728-185886750 AGCAGCACCATGAGAGAACCGGG + Intronic
985983498 5:3491135-3491157 AGTTGCCCCATGGGAGGCACGGG + Intergenic
986279869 5:6314251-6314273 ATCTGCCCCACGAAAGACACAGG - Intergenic
986506950 5:8461910-8461932 GGCTGCACCATCTGAGACACGGG - Intergenic
990478369 5:56184154-56184176 TGCTTGCCCATGAGAGGCACGGG + Intronic
991955948 5:71996192-71996214 TGCTGCCTCATGACAGACTCTGG + Intergenic
992917389 5:81472258-81472280 AGCTTTCCCAAGAGAGACAAAGG + Intronic
995983840 5:118143727-118143749 AACAGCCCCATGAGAGATAATGG - Intergenic
999519177 5:152332828-152332850 ACCTGTCCCATGAGATACTCTGG - Intergenic
1000631878 5:163599888-163599910 AGCTCCTGCAGGAGAGACACAGG - Intergenic
1001424805 5:171616156-171616178 AGCAGCCCCCTCAGAGACACAGG + Intergenic
1002520428 5:179790100-179790122 AGCTGCCCCAGTAAAGACTCAGG + Intronic
1003575872 6:7293826-7293848 AGTTGACCCTTGAAAGACACAGG - Intronic
1006495280 6:34418583-34418605 GGGTGCCCCAGGAGAGACAAAGG - Intronic
1007186189 6:39974486-39974508 AGAAGCCCCAGGAGAGCCACAGG + Intergenic
1007810276 6:44480694-44480716 AACTGACCCCTGAGAGCCACAGG - Intergenic
1010283792 6:74051197-74051219 AGCTGCACCCAGAGAGGCACAGG - Intergenic
1010409803 6:75548073-75548095 AGATGCCTCCAGAGAGACACAGG + Intergenic
1011818749 6:91225051-91225073 ACCTGCCCCTTGGGAGAAACAGG - Intergenic
1014450577 6:121576943-121576965 AGCTGGCCCATGAAAGAGAATGG - Intergenic
1015856177 6:137626804-137626826 AGCTTCCCCAAGGGAGCCACGGG + Intergenic
1018170513 6:161139955-161139977 TGCTGCCCCATTAGACAGACTGG - Intronic
1019138344 6:169926634-169926656 TGCTGCCCCGTGAGTGAGACAGG - Intergenic
1019607899 7:1919178-1919200 AGCTTCCCCATTTGAGAAACGGG - Intronic
1021134417 7:16948359-16948381 AGCTGGCACATCTGAGACACAGG - Intergenic
1029250454 7:99232696-99232718 AGATGCCCCCTGAGGGACCCAGG + Intergenic
1033476476 7:141698007-141698029 AGCTGCCCCAGTACAAACACAGG + Intronic
1036579898 8:10064033-10064055 ATCTCCCCAAGGAGAGACACTGG - Intronic
1037635456 8:20697967-20697989 AGCGGCCCCATGAGATAAATAGG + Intergenic
1040316202 8:46262176-46262198 GGGTGTTCCATGAGAGACACAGG - Intergenic
1040422356 8:47252133-47252155 ATCACCCCCATGTGAGACACTGG - Intergenic
1040566243 8:48570495-48570517 ACCAGACCCATGAGAGACAAAGG - Intergenic
1044692749 8:94895740-94895762 AGCTGGCCAATGGGAGGCACGGG + Intronic
1044915238 8:97106507-97106529 AGCTGCTCCTTGGGAGCCACTGG + Intronic
1045890896 8:107155873-107155895 ATCTGCCTCAAGAGAGATACAGG - Intergenic
1046535094 8:115498872-115498894 AGCTGCCCTGTGATAGAAACAGG - Intronic
1048670009 8:136707805-136707827 AGCTGCACCATATGAGACAGCGG - Intergenic
1049005152 8:139850397-139850419 TCCTGCCCCATGAGGGGCACTGG - Intronic
1049218769 8:141419398-141419420 TGCTGCCCCAAGAGGGACCCAGG + Intronic
1049673830 8:143880992-143881014 AGGTGTCCCCTGAGAGCCACTGG - Intergenic
1049698184 8:143993856-143993878 AGCCTCCCCATGAGAAACACAGG + Intronic
1050614163 9:7384212-7384234 AGCTACCCCCTGAGAGAGAGAGG - Intergenic
1051729765 9:20128299-20128321 TGTTGCCAGATGAGAGACACAGG + Intergenic
1053106224 9:35411012-35411034 ATCTGCCACATGATAAACACTGG + Intergenic
1055323184 9:75101744-75101766 AGCTGACCCAACAGATACACAGG - Intronic
1056702314 9:88920941-88920963 AGCTCCCCCATCCAAGACACTGG - Intergenic
1056792632 9:89635939-89635961 AGCTGCCCCATGTAAGAACCAGG + Intergenic
1057308454 9:93926190-93926212 AGGTGTCCCAGCAGAGACACGGG + Intergenic
1057840455 9:98481911-98481933 ACCTGACCCATGAGAGCCTCTGG - Intronic
1059392307 9:114006896-114006918 AGCTGCCCCATGAGAGACACAGG - Intronic
1060040499 9:120296144-120296166 TGCTGCCCCATGCCAGTCACAGG + Intergenic
1061685121 9:132269906-132269928 AGCATCCTCATGTGAGACACAGG + Intronic
1061685128 9:132269988-132270010 AGCATCCTCATGTGAGACACAGG + Intronic
1061685135 9:132270070-132270092 AGCATCCTCATGTGAGACACAGG + Intronic
1061685142 9:132270152-132270174 AGCATCCTCATGTGAGACACAGG + Intronic
1061685145 9:132270193-132270215 AGCGTGCCCATGTGAGACACAGG + Intronic
1061685153 9:132270275-132270297 AGCGTGCCCATGTGAGACACAGG + Intronic
1061685165 9:132270433-132270455 AGCATGCCCATGTGAGACACAGG + Intronic
1188933132 X:36140063-36140085 ACCTCCCTCATGAAAGACACTGG + Intronic
1189601868 X:42635551-42635573 AGGTGCCTCGTGAGAGAAACAGG + Intergenic
1190808776 X:53864045-53864067 AGCTGCCCCATGTGAAACCTGGG - Intergenic
1197136262 X:123063487-123063509 AGCTGCCCCTTGAACAACACAGG + Intergenic
1198766153 X:140081040-140081062 AGCTACCACATTAGGGACACAGG - Intergenic
1199944146 X:152652296-152652318 AGCTGCCTCCAGCGAGACACTGG + Intronic
1200977252 Y:9226477-9226499 AGCTGCCCCAGGAGAAACTTGGG - Intergenic