ID: 1059392309

View in Genome Browser
Species Human (GRCh38)
Location 9:114006924-114006946
Sequence GGTCACACCTGCTGGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059392309_1059392313 -10 Left 1059392309 9:114006924-114006946 CCCAGCAGCCAGCAGGTGTGACC 0: 1
1: 0
2: 2
3: 28
4: 234
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059392309 Original CRISPR GGTCACACCTGCTGGCTGCT GGG (reversed) Intronic
900602942 1:3510857-3510879 GTGCACACCTGCTGGCAGCACGG + Exonic
900968958 1:5978731-5978753 TCTCTCACCTGTTGGCTGCTGGG - Intronic
902889020 1:19428038-19428060 GGTCACCCATTCTGGCTGGTGGG - Intronic
903580896 1:24369914-24369936 GAACACACCTGATGGCTGCAAGG + Intronic
905205205 1:36339453-36339475 GGTGCCACCCGCTGGCTGCGGGG + Intergenic
906151224 1:43588763-43588785 GGCATCACCTCCTGGCTGCTGGG - Exonic
906209264 1:44003090-44003112 TGTCACACAAGGTGGCTGCTGGG - Intronic
911168484 1:94745958-94745980 GGTAAAACCTGCTGGCTTCCAGG - Intergenic
912234499 1:107835077-107835099 TGTAACCCCTGCTGACTGCTAGG + Intronic
912754383 1:112312383-112312405 GATCAAACCAGCTGGCTCCTAGG + Intergenic
913050606 1:115114005-115114027 GGCGTCACATGCTGGCTGCTAGG + Intergenic
916631060 1:166613020-166613042 GGTCACACCTGCTGACTGACTGG + Intergenic
923032933 1:230264132-230264154 GGTCACAGTTGCTGGTTGCAGGG + Intronic
923033153 1:230265619-230265641 GGTCACAGTTGCTGGTTGCAGGG + Intronic
923746613 1:236706849-236706871 AGGCGCACCTGCTGGGTGCTGGG + Intronic
1063190847 10:3693395-3693417 GGTTGCACCTGCTGCGTGCTGGG + Intergenic
1067298962 10:44992507-44992529 GGTCTCACCTGCCAGCTCCTGGG + Intronic
1068715876 10:60187871-60187893 GCTGACAGATGCTGGCTGCTGGG - Intronic
1069631148 10:69897658-69897680 GGTCACAGCTGCTGCCTTCTTGG - Intronic
1069707795 10:70469567-70469589 GGCCACCCCTGCCTGCTGCTGGG + Intergenic
1069882724 10:71603600-71603622 GGCCCCCCCTGCTGCCTGCTTGG - Intronic
1070788110 10:79174065-79174087 GGGCCCACTTGCTGGGTGCTTGG + Intronic
1071495964 10:86167884-86167906 GGTCACAACTGCTTGCCTCTGGG - Intronic
1071829629 10:89359048-89359070 CCTGACACCTGCTGGCTGATGGG - Intronic
1073432461 10:103494948-103494970 GGTCAGAGCTGCTGGTTCCTGGG + Intronic
1074048508 10:109861183-109861205 GGTAACAGGTGCTGGGTGCTTGG - Intergenic
1075105707 10:119538753-119538775 GGCCACTGCTGCTGCCTGCTGGG + Intronic
1075411891 10:122234233-122234255 GGTCCTTCCTGCTGGCAGCTGGG - Intronic
1075581007 10:123618447-123618469 GGTGGCCCCTGCTGGCTCCTGGG - Intergenic
1076118792 10:127920047-127920069 GGCCACACTTCCTGCCTGCTAGG - Intronic
1076238515 10:128884219-128884241 GGTCACACCTCCTTGCTGGGCGG + Intergenic
1076668190 10:132104705-132104727 GGTGACACCTGCTGGGAGCTTGG + Exonic
1076896580 10:133316131-133316153 GGTCACCACTGCTGGCTGGGTGG - Intronic
1078469871 11:11578221-11578243 GTACAAACCTGATGGCTGCTGGG - Intronic
1078803600 11:14672607-14672629 GGTCACACATTCAGGCTGCTGGG + Intronic
1079226782 11:18613745-18613767 GGTGGCACCTGCTAGCTGCTAGG - Intronic
1080250235 11:30225754-30225776 GGTCTCACCTTCTGGCTTCTGGG - Intergenic
1080535833 11:33220747-33220769 GTTCAGACTTGCTTGCTGCTAGG + Intergenic
1080926759 11:36765315-36765337 TGTCACACCTTCTTGCTGCATGG - Intergenic
1083535863 11:63466102-63466124 GGTCACACCTGCTGGCTCCGGGG + Exonic
1083603850 11:63965199-63965221 GCTCAGACCTGCTTGCTGTTGGG + Intergenic
1083665264 11:64270607-64270629 GGTCTCATCTTCTGGGTGCTAGG - Intronic
1084565447 11:69926006-69926028 GGTCACACCTCATGGCTGGTTGG + Intergenic
1084958358 11:72703320-72703342 CCTCACCCCTGCTGGCTGCCTGG + Intronic
1084981553 11:72831624-72831646 GGTGACCCCTGGTGGCTGCTGGG - Intronic
1085042413 11:73334446-73334468 GGTCACACACGTAGGCTGCTGGG + Intronic
1085080238 11:73627904-73627926 GTTCACGCTGGCTGGCTGCTAGG + Intergenic
1085523000 11:77149214-77149236 GGTCCCTCCTGCTCTCTGCTGGG - Intronic
1087749862 11:101995418-101995440 GGTCATACCTGAGGGCAGCTTGG + Intronic
1088888582 11:114027070-114027092 GGACACAGGTGCTGGCTACTGGG + Intergenic
1088944472 11:114495618-114495640 GGTCACACCTGCAGCCAGCATGG + Intergenic
1089800680 11:121024369-121024391 GGTCGCTCCTGCAGGGTGCTGGG + Intronic
1092103388 12:5903891-5903913 GGTCACCCCTTCCTGCTGCTAGG - Intronic
1095259505 12:40082502-40082524 GGCCACACCTGCTTGCAGCATGG - Intronic
1097048658 12:56206765-56206787 GGTCACTCTTGCTGGCTGAAGGG + Exonic
1100312858 12:93413755-93413777 GGTCAGAGCTGATGGTTGCTTGG - Intronic
1101642862 12:106601178-106601200 GGCCACAGCTGCTGGCTTCCTGG + Exonic
1102008070 12:109601404-109601426 GCTCACCCCTGCTGCCCGCTTGG + Intergenic
1103069174 12:117926642-117926664 TGTCACCGCTGGTGGCTGCTGGG - Intronic
1103923300 12:124410600-124410622 TTTCAAACCTGCTGCCTGCTTGG - Intronic
1105546186 13:21352613-21352635 GGTCACACATGCTGGCTTGGTGG + Intergenic
1106414446 13:29534672-29534694 GGCCACACATGCTGCCTGCTGGG - Intronic
1109206867 13:59492391-59492413 GGTCACATTTCCTGTCTGCTTGG - Intergenic
1113535154 13:111060385-111060407 GCTCACACCTTCTAGCTACTTGG + Intergenic
1114021828 14:18486711-18486733 GGACACTGCTGCTGGCTTCTGGG + Intergenic
1114680776 14:24482140-24482162 AGTCACAGGGGCTGGCTGCTGGG - Intergenic
1116656284 14:47657480-47657502 GGTCCCTCCTGCTGGCAGGTTGG - Intronic
1117087586 14:52217807-52217829 AGTCACACCTGCTGGCACCTTGG - Intergenic
1118350615 14:64970998-64971020 GGAAACACCTGCTGGCTGGCTGG - Intronic
1118539908 14:66812035-66812057 GCTAAAACCTGCTGGCTTCTTGG + Intronic
1118638401 14:67769212-67769234 GTTCACACCTGCTGAATGGTTGG - Intronic
1118971809 14:70643242-70643264 CCTCACGCCAGCTGGCTGCTAGG + Intronic
1119033224 14:71208663-71208685 GCATACACCTGCTGGCTCCTTGG - Intergenic
1122204719 14:100142806-100142828 GGTCACACCGCCTTACTGCTGGG + Intronic
1122271341 14:100569603-100569625 GGCCAAGCCTGCTGGGTGCTGGG - Intronic
1122446265 14:101771773-101771795 GCTAACACCTGCAGGCTGCAGGG - Intronic
1124070532 15:26388667-26388689 GATCACACCAGGTGGCTGGTTGG + Intergenic
1125323673 15:38514818-38514840 GGTCAAACTGGCAGGCTGCTTGG - Intronic
1126907603 15:53384599-53384621 AGTGCCACCTGCAGGCTGCTAGG - Intergenic
1128726128 15:69989809-69989831 GGTCACACCCACTAGGTGCTGGG + Intergenic
1129604080 15:77016335-77016357 GGTCAGAGCTCCTGGCGGCTGGG - Intronic
1129892430 15:79080270-79080292 GGTCACATCTGCAGGCAGCAAGG - Intronic
1130772236 15:86936065-86936087 GGTCTCACAGGCGGGCTGCTCGG + Intronic
1131560172 15:93432667-93432689 GCTCACACCTGGGCGCTGCTGGG + Intergenic
1132802728 16:1762283-1762305 GGTGACACCTGCTTCCTCCTGGG - Intronic
1135925166 16:26687623-26687645 ATTCACACTTGCTGGCTGCATGG + Intergenic
1136989248 16:35142131-35142153 TGTCCCACCTGATGGCTGCGTGG + Intergenic
1136989783 16:35145030-35145052 TGTCCCACCTGATGGCTGCGTGG + Intergenic
1138589469 16:57991863-57991885 GCTCAGACCTGCTGGCGGATGGG + Intergenic
1139847175 16:69929359-69929381 GTTCCCACCTCCTGGGTGCTGGG - Intronic
1139848238 16:69935351-69935373 GGTCTGTCCTGCTGGCTGCTGGG - Intronic
1139920205 16:70454874-70454896 GGCCGGACCTGCTGGCAGCTGGG + Intronic
1140449084 16:75055609-75055631 GGACACACCAGCTGCCTGCCTGG + Intronic
1141612204 16:85188024-85188046 GGTACCACCTGCAGGGTGCTGGG + Intergenic
1142144866 16:88488693-88488715 GGTCCCCTCTGCTGGCAGCTGGG - Intronic
1142238932 16:88936275-88936297 GGTCCCACCTGCTGCCTCCCCGG + Intronic
1143184531 17:5002296-5002318 GGACACACCTCCTGGCTTGTTGG + Intronic
1144845840 17:18218548-18218570 GGGCACACCTGCTCCCTGCAAGG - Intergenic
1145994920 17:29099663-29099685 GGTAGCCCCTGCAGGCTGCTTGG + Exonic
1148209027 17:45797080-45797102 GGTGACCACTGCTGGCTTCTGGG + Intronic
1148491220 17:48025105-48025127 GGTCACGCGTGCAGGTTGCTAGG + Intergenic
1150571983 17:66394499-66394521 GGGCACACCTGCTGGGTTCTAGG + Intronic
1151167695 17:72219408-72219430 GGCCACATCTGCTGGCTGGCAGG - Intergenic
1152609365 17:81308087-81308109 GGTCTCACCCTCTGGCTGCTGGG - Intergenic
1153950276 18:10052606-10052628 GATAACACCTGCTTGCTGCTTGG - Intergenic
1154314797 18:13296137-13296159 GGTCATGCCTCCTGGCTTCTGGG - Intronic
1157610440 18:48952002-48952024 GGGCACACTCGCTTGCTGCTCGG - Intergenic
1158848929 18:61474527-61474549 AGTCCCACCTGCTGGTTCCTCGG + Intronic
1159913015 18:74164414-74164436 GCTCACAGCTGCTGTCAGCTAGG + Intergenic
1160450351 18:78959409-78959431 GTTCACAGCTGCTGACTGATGGG + Intergenic
1161330436 19:3684328-3684350 GGGGACACCTGCTGCCTGCCAGG + Intronic
1163746851 19:19053962-19053984 AGTGCCCCCTGCTGGCTGCTGGG - Intronic
1164257740 19:23543931-23543953 GGTCACACCACCTAGGTGCTAGG + Intronic
1164283383 19:23788962-23788984 AGTCACATCTTCTGGGTGCTGGG - Intronic
1164757313 19:30699853-30699875 GGTCAGGCCTGCAGGGTGCTTGG - Intronic
1165815531 19:38639844-38639866 GGTCAGGCCGGCTGGCAGCTTGG - Intergenic
925059660 2:881176-881198 TGTGGCACCTGATGGCTGCTGGG - Intergenic
925367105 2:3318043-3318065 GGTCACACCTGCTTCCTGCTGGG + Intronic
925415915 2:3670085-3670107 GGTCACACCTGCGGGCTGGAAGG - Intronic
926223423 2:10951155-10951177 GGTCTCACATGGTGTCTGCTGGG + Intergenic
926712104 2:15889985-15890007 GGTCACAGCTGGTGACAGCTTGG - Intergenic
927897207 2:26790803-26790825 GGTCTCCTCTGCTGGCTGCCTGG + Intronic
928614627 2:33024885-33024907 TGCCACCCCTGCTGACTGCTTGG - Intronic
929549342 2:42879612-42879634 TTCCACACCTGCTGGCAGCTGGG + Intergenic
929561775 2:42960695-42960717 TGTCCCACCTCCTGGCTCCTAGG + Intergenic
929915748 2:46134133-46134155 GTTCACATCATCTGGCTGCTTGG + Intronic
931629361 2:64285240-64285262 GGGCACAGTTGCTGGCTGCTTGG + Intergenic
931701568 2:64913428-64913450 GGTGACACCTGGTGGCAGCCAGG + Intergenic
934490807 2:94761091-94761113 GGTCACTCCTGCTGGATGTCTGG - Intergenic
935499730 2:103823940-103823962 GGTCACAACTGCAGGTTGCTAGG - Intergenic
936081630 2:109436440-109436462 CCTCGCATCTGCTGGCTGCTGGG - Intronic
938329058 2:130436191-130436213 GGCCACTGCTGCTGGCTGTTGGG + Intergenic
938360886 2:130685301-130685323 GGCCACTGCTGCTGGCTGTTGGG - Intergenic
938609958 2:132937213-132937235 AGACACAGGTGCTGGCTGCTAGG + Intronic
940109438 2:150135369-150135391 AATCACACCAGCTGGCCGCTTGG - Intergenic
940672499 2:156687944-156687966 GGCCCCACCTGCTGACTGCTGGG + Intergenic
944078584 2:195759435-195759457 GGTCACACCTGAAGCCTGCATGG - Intronic
946981247 2:225218205-225218227 TATCACAGCTGCAGGCTGCTTGG + Intergenic
947135841 2:226976032-226976054 GGTCACAAGTCCTGGCTGTTTGG + Intronic
948469270 2:238166899-238166921 GGTCACCTCTGCAGGCTGTTGGG + Intronic
948756897 2:240165303-240165325 GGCCAGCCCTGCTGCCTGCTGGG + Intergenic
948815767 2:240509792-240509814 AGTCACACCTGCTGTATGCCAGG - Intronic
948869471 2:240791081-240791103 GCTCCCTCCTGCTGGCTGCCCGG - Intronic
1169001971 20:2174422-2174444 AGACACAGGTGCTGGCTGCTGGG + Intronic
1170207979 20:13820075-13820097 CGTGACACCTGTTGGCTGCCAGG + Exonic
1170642520 20:18167072-18167094 GATCAGACCTCCTGGCTTCTGGG + Intronic
1170744994 20:19091378-19091400 AGGCACAGGTGCTGGCTGCTGGG - Intergenic
1173539125 20:43838268-43838290 GGTAAGAGGTGCTGGCTGCTTGG + Intergenic
1173810740 20:45953667-45953689 GGTGAGACCTGCTGCCTGCAAGG - Exonic
1174080794 20:47969499-47969521 GGTCACACCTCCAGGCTGTCAGG - Intergenic
1174225456 20:48995429-48995451 GCTCACACCTGCTGAATGCTTGG - Intronic
1174496599 20:50948584-50948606 CCTCACACCTGCTGCTTGCTTGG - Intronic
1175264273 20:57693112-57693134 AGACACAGCTCCTGGCTGCTGGG - Intronic
1178541798 21:33457964-33457986 GGTCTCATCAGTTGGCTGCTTGG - Intronic
1180446288 22:15417057-15417079 GGACACTGCTGCTGGCTTCTGGG + Intergenic
1181669475 22:24419474-24419496 GGGCACACCTGCTTCCTGCCTGG - Intronic
1181787212 22:25235992-25236014 GCTGACACCTGGTGGCTGCAGGG - Intergenic
1181819236 22:25462703-25462725 GCTGACACCTGGTGGCTGCAGGG - Intergenic
1182441984 22:30370031-30370053 GGTCACAGCTGCTGGTTACTGGG - Intronic
1183057542 22:35316112-35316134 TGGCACACCTGCTGGCTGATGGG - Intronic
1183437395 22:37803901-37803923 GGTCTCTCCTGCTGGCCTCTGGG + Intergenic
1183605853 22:38866433-38866455 GGTCACAGCTGCTGCCGGCCCGG - Exonic
1183749100 22:39709212-39709234 TCTCCCACCCGCTGGCTGCTTGG - Intergenic
1184258109 22:43298521-43298543 GGTGAAGCCTGCTGGCCGCTGGG + Intronic
1184389700 22:44196303-44196325 CATCACACCTGCTGTGTGCTAGG + Intronic
1184496490 22:44845425-44845447 GGTCACACCCCCTGGCTTGTGGG - Intronic
1184511701 22:44937354-44937376 GTTCACACCTGGTGGCCGCCTGG - Intronic
1185007368 22:48289182-48289204 GATCAAACCTGCTGGCTGAGAGG - Intergenic
949982499 3:9510565-9510587 CATAACACCTCCTGGCTGCTTGG - Intronic
950140735 3:10613398-10613420 GGTCAGAACTGCGGGCAGCTTGG + Intronic
950408880 3:12821463-12821485 GGTCACGTCTGCTGGCCCCTTGG - Intronic
951660284 3:25055842-25055864 AGTCACAGGTGCTGGCTGTTGGG + Intergenic
954164856 3:48748569-48748591 AGTCACTCCTGCAGTCTGCTAGG - Exonic
955009008 3:54996402-54996424 GGGCAAACCAGCTGGCAGCTAGG + Intronic
955508432 3:59655266-59655288 GGGCACACCTGCTGCTTGCTTGG + Intergenic
955828962 3:62981046-62981068 GCTCACACATGCTGAATGCTTGG + Intergenic
959933178 3:112004108-112004130 GGTCACCCCAGCTCCCTGCTAGG - Intronic
961336103 3:126180561-126180583 GGTCCCACCTCCTGGCTCCCAGG - Intronic
961450045 3:126998562-126998584 GGCCTCACCAGCTGGGTGCTAGG + Intronic
963272858 3:143302688-143302710 GACCAAACCTGCTGGCTGGTTGG - Intronic
964628343 3:158781067-158781089 GGTCACATGTCCTGGCTGCAAGG + Intronic
965761496 3:172082361-172082383 CGACACAGCTGCTGGATGCTTGG + Intronic
966719201 3:183044708-183044730 AATCTCACCTGCTGGCTGCCCGG + Intronic
967366206 3:188689101-188689123 GGACACTTCTGCTGCCTGCTTGG + Intronic
968292146 3:197547176-197547198 GGTAACACCTTAAGGCTGCTAGG + Intronic
968347429 3:198021904-198021926 GGTCATACCTTCTAGCTGCACGG + Intronic
968452855 4:683312-683334 GCTGCCACCTGCTCGCTGCTCGG - Exonic
968663929 4:1810525-1810547 GGACACAACTGGTGGCTCCTGGG + Intergenic
968731410 4:2270979-2271001 GGTCACAACCCCTGGCAGCTGGG - Intronic
968898840 4:3421168-3421190 TCTCACACCTGCTCACTGCTTGG + Intronic
969321637 4:6416537-6416559 GGTCACAGCTGCTTTCTGTTGGG - Intronic
969635385 4:8366134-8366156 GGTCACTCCTGCTCCCTGCAGGG - Intergenic
977468502 4:97412464-97412486 GGTCACACTGGATGTCTGCTTGG - Intronic
977830969 4:101592171-101592193 GGTGACACCTGTTTCCTGCTGGG + Intronic
982116117 4:152099735-152099757 GGTGACTCCTGCTGGCCCCTGGG - Intergenic
998207142 5:140166026-140166048 TGTCACACCTGAAGGCTCCTAGG + Intergenic
998929905 5:147170025-147170047 TGTCACACCTGATGGGTGCAGGG + Intergenic
1001658554 5:173373224-173373246 GGTCACATCTCCTGTCTGCCTGG - Intergenic
1002181124 5:177431617-177431639 GCCCACACCTGCTGCCTGCCTGG - Intronic
1003111077 6:3252682-3252704 GGGAACGCCTGCAGGCTGCTGGG + Intronic
1006094563 6:31647767-31647789 GGTCACAGCCGGTGGCTGCGGGG + Exonic
1006179721 6:32147616-32147638 GGTCACACCTGCTGTCTGGGTGG + Intergenic
1006220385 6:32484541-32484563 TGTCACACCTTCTGGCAGCCTGG - Intergenic
1007115472 6:39340117-39340139 GGTCACGCCTGCTGGCCCTTTGG + Intronic
1008182914 6:48355700-48355722 AATCACTCCTGCTTGCTGCTTGG + Intergenic
1008613270 6:53203697-53203719 GGGAACACCTGCTGTCTGCCAGG - Intergenic
1014691101 6:124564497-124564519 GGTTGCTCCTGCTGGCTGGTGGG - Intronic
1018638319 6:165884195-165884217 GGGCACACGTGGTGTCTGCTGGG + Intronic
1018879835 6:167866593-167866615 AATCACAGCTGCTGTCTGCTGGG + Intronic
1019333840 7:473403-473425 TGACACACCTCCTGGCTGCTGGG - Intergenic
1021208755 7:17817531-17817553 GGACAAATCTGATGGCTGCTTGG + Intronic
1021562834 7:21986163-21986185 GGTCACACCTTATCCCTGCTGGG + Intergenic
1023814374 7:43938390-43938412 GGTCAGAGCTGCTGTATGCTGGG - Intronic
1024634333 7:51275170-51275192 GGTCACCCCTGCGGGCTGGAGGG + Intronic
1025161494 7:56665103-56665125 AGTCACATCTCCTGGGTGCTAGG - Intergenic
1025223678 7:57138031-57138053 AGTCACATCTCCTGGGTGCTAGG - Intronic
1025751141 7:64294814-64294836 AGTCACATCACCTGGCTGCTGGG + Intergenic
1025780917 7:64601131-64601153 TGTCACATCAGCTGGGTGCTGGG - Intergenic
1025780966 7:64601478-64601500 AGTCACATCAGCTGGGTGCTGGG - Intergenic
1025784163 7:64628937-64628959 GGTCACATCAGCTGGGTGTTAGG - Intergenic
1029014304 7:97298969-97298991 GGACAGAACTGCTGGCTTCTGGG + Intergenic
1030310891 7:108068145-108068167 GGTGACACTTGCAGGCTGCAAGG + Exonic
1031353481 7:120763184-120763206 GGTCACACCTGAAGCCAGCTTGG + Intergenic
1034201358 7:149285057-149285079 GGCGACACCTGCGGGCTGTTGGG + Intronic
1035642349 8:1193796-1193818 GGTCTCAGGTGCTGGCTGCAGGG - Intergenic
1037653545 8:20862951-20862973 GGTCACCCTAGCTGGGTGCTTGG + Intergenic
1038614007 8:29076349-29076371 GGGCACAGCTGGTGGCTGCTCGG + Intronic
1039228983 8:35422143-35422165 GGTGACAACTGGTGGCAGCTCGG - Intronic
1039474596 8:37833103-37833125 GGTCACACCGGCGGGAGGCTCGG - Exonic
1040285883 8:46100122-46100144 GGACACACCTGTGGGCTTCTGGG + Intergenic
1040287296 8:46106943-46106965 GGACAGACCTGGTGGCTTCTGGG + Intergenic
1040291431 8:46127551-46127573 GGACACACCTGGGGGCTTCTGGG + Intergenic
1040300431 8:46185148-46185170 GGACATACCTGGTGGCTTCTGGG + Intergenic
1040311817 8:46240723-46240745 GGACACACCTGGGGGCTTCTGGG - Intergenic
1043155629 8:76775656-76775678 GCTCACACCTGCAGGCTTCCTGG + Intronic
1044924596 8:97199531-97199553 GGTCACTCCTGTTGACAGCTAGG + Intergenic
1048352109 8:133624675-133624697 GTTCACACCTGCTAGCAGCAGGG + Intergenic
1049010943 8:139886981-139887003 GGTCTCTCCTGCTGGCTCATGGG + Intronic
1049226069 8:141451096-141451118 GCTCACACCTGCTGACTGGGGGG - Intergenic
1050204424 9:3181810-3181832 GGTGACACCTGCTGTTCGCTGGG + Intergenic
1053061710 9:35036912-35036934 TCTGAGACCTGCTGGCTGCTGGG + Intergenic
1053136031 9:35650682-35650704 GGTCCCACCTGCTGGGCCCTGGG - Intronic
1055852094 9:80644261-80644283 GCTCACACCTGCTGCCTGGGAGG - Intergenic
1057173485 9:92977449-92977471 GGTCAGGCTTGCTGGCTCCTAGG + Intronic
1058627783 9:106953297-106953319 GTTTACACCTGCTGCCTCCTTGG + Intronic
1059392309 9:114006924-114006946 GGTCACACCTGCTGGCTGCTGGG - Intronic
1061484740 9:130914555-130914577 GGGCACGCCCACTGGCTGCTGGG - Intronic
1061592182 9:131604773-131604795 GCGCACACCTGCTGGCAGCATGG - Intronic
1061813981 9:133182218-133182240 GGTCACACCTGCTGGGTGAATGG + Intergenic
1061883553 9:133579648-133579670 AGTCACACCTGCACGTTGCTGGG - Intronic
1062154733 9:135040496-135040518 GGTCGCTCCTGCTCACTGCTGGG - Intergenic
1062270364 9:135705501-135705523 GGTCACACAAGCTGGCTGGCGGG - Intronic
1062312576 9:135946971-135946993 AGACACACATGCTGGCTGCTGGG + Intronic
1062326540 9:136015180-136015202 GGCCACAGCTGCTGGAGGCTGGG + Intronic
1062533862 9:137013159-137013181 AGTCGCGCCTGCTGGCGGCTCGG - Exonic
1062566150 9:137164821-137164843 GGCCACACCAGCTGTCTGCGTGG - Intronic
1185695640 X:2192437-2192459 GGCCACACCTGCAGGCTCCCAGG - Intergenic
1189238439 X:39507020-39507042 AGCCACACCTGATGCCTGCTTGG + Intergenic
1189993467 X:46616192-46616214 GGTGACACATGCTAGCTACTTGG + Intronic
1192320798 X:70089063-70089085 GGCCAAACCAGGTGGCTGCTGGG + Intergenic
1196048041 X:111276568-111276590 GGGGGCACCTGCTGGGTGCTCGG + Intergenic
1196754132 X:119143218-119143240 GGACAAACCTGCTGGTTACTGGG - Intronic
1196758838 X:119181664-119181686 GGTGCCACCTACAGGCTGCTGGG + Intergenic
1197723650 X:129761438-129761460 GGCCAGTCCTGCTGGCTGCTTGG + Intronic
1199845254 X:151688245-151688267 GGTCACACCTGCAGCCAGCATGG - Intergenic