ID: 1059392313

View in Genome Browser
Species Human (GRCh38)
Location 9:114006937-114006959
Sequence AGGTGTGACCTGGACAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059392303_1059392313 26 Left 1059392303 9:114006888-114006910 CCTGGTCACCTGTGTCTCTCATG 0: 1
1: 0
2: 0
3: 25
4: 228
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data
1059392307_1059392313 18 Left 1059392307 9:114006896-114006918 CCTGTGTCTCTCATGGGGCAGCT 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data
1059392309_1059392313 -10 Left 1059392309 9:114006924-114006946 CCCAGCAGCCAGCAGGTGTGACC 0: 1
1: 0
2: 2
3: 28
4: 234
Right 1059392313 9:114006937-114006959 AGGTGTGACCTGGACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059392313 Original CRISPR AGGTGTGACCTGGACAGAGA AGG Intronic
No off target data available for this crispr