ID: 1059392336

View in Genome Browser
Species Human (GRCh38)
Location 9:114007130-114007152
Sequence TCCCCAAGGCTGCTCATCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059392336 Original CRISPR TCCCCAAGGCTGCTCATCAC CGG Intronic
900603397 1:3512912-3512934 TCCCCAAGGCTGCTTGGCCCAGG + Intronic
900624915 1:3603668-3603690 TCCCCCAGCCTCCTCATCAGAGG + Intronic
902645384 1:17794162-17794184 TGGCCAAGGCTGCTCAGCAGTGG + Intronic
903008766 1:20315889-20315911 TGCACAAGGCTCGTCATCACTGG - Intronic
903916240 1:26766471-26766493 TCCCCAAGGCCCATCATCTCTGG - Exonic
905320675 1:37114608-37114630 TCCCCAAGTCTGCTGACCATGGG + Intergenic
905440716 1:37995191-37995213 TCTACAACTCTGCTCATCACAGG + Intergenic
907257250 1:53189100-53189122 TCCCCCTGGCTGCTCCTCTCAGG + Intergenic
907441163 1:54479351-54479373 TACCCAAGGCCGTTCATCAAAGG + Intergenic
908852317 1:68387935-68387957 CTCCCAAGGCTGCTCCTCTCCGG + Intergenic
909835533 1:80249829-80249851 TCCCCTAGCCTGCTCTTCACTGG - Intergenic
913573289 1:120142922-120142944 TCCACAAGACTCCTCATCAGAGG + Intergenic
914294548 1:146307719-146307741 TCCACAAGACTCCTCATCAGAGG + Intergenic
914555592 1:148758502-148758524 TCCACAAGACTCCTCATCAGAGG + Intergenic
914747040 1:150508617-150508639 GCCCCCAGGCTGCTCAAAACCGG + Intronic
914877662 1:151524410-151524432 TCCTCAAGTCTGCTCATCCATGG + Intronic
915623261 1:157099007-157099029 ACCACTAGGCTGCTCACCACAGG + Intronic
916232826 1:162557126-162557148 TCCCCAAGGCTGCTTATAAAAGG + Intergenic
922472945 1:225887887-225887909 TCCCCAAGGCCGCGCTGCACAGG - Exonic
922480949 1:225939857-225939879 TCCCCAAGGCCGCGCTGCACAGG - Exonic
923284740 1:232482733-232482755 TCCCCAAGTCTGCTCAACTTGGG - Intronic
923668151 1:236016800-236016822 ACCCCAAGGCTACTAATTACTGG + Intronic
924677798 1:246198157-246198179 AGCCCAAAGCTTCTCATCACAGG + Intronic
1062858391 10:790996-791018 TCCCCAAGGCGGCTCCTTCCAGG + Intergenic
1063136436 10:3221064-3221086 TCCCAGAGACTGCTCAGCACAGG + Intergenic
1063698716 10:8363964-8363986 TCCCCCACGCTGCACATCTCAGG - Intergenic
1063910273 10:10821969-10821991 GCCCCAAGGCTTCTCAGCAGGGG - Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1069072168 10:64000008-64000030 TCCCCAAGACAGATAATCACTGG + Intergenic
1069772416 10:70908084-70908106 TCCCCATGGCTTCTCTTCAGTGG + Intergenic
1075950517 10:126473620-126473642 TCCCCCAGGCTGCCCACCTCTGG + Intronic
1076335156 10:129702035-129702057 TCTGCAAGGCAGTTCATCACTGG + Intronic
1077463266 11:2721557-2721579 TCCCAAAGGCTGCTGACCGCCGG - Intronic
1078761263 11:14253667-14253689 ACCCCAAGGCTGCTAATCATGGG - Intronic
1079308407 11:19344580-19344602 TCCCCAAGGTTACCCATCTCCGG - Intergenic
1080808380 11:35677959-35677981 TCCCTAGAGCTTCTCATCACTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083332025 11:61903149-61903171 TCCCCAAACCTGCTCTTCACTGG + Intronic
1084733836 11:71091823-71091845 TCCCCAAGACTGCTCTTCTATGG + Intronic
1084771918 11:71348881-71348903 CCCCTAAAGCTGCTCAGCACTGG + Intergenic
1085023548 11:73223616-73223638 TCACCAAGACTGCACAGCACAGG + Intronic
1087615989 11:100487060-100487082 ACCCAAAGACTGCACATCACAGG + Intergenic
1088246353 11:107821783-107821805 TCCCCAAGGCAGCTTCACACTGG + Intronic
1088553927 11:111042518-111042540 TCACCAAAGTTCCTCATCACTGG - Intergenic
1089897677 11:121948030-121948052 TCCCCAGGGCTGCTTATGACAGG - Intergenic
1091663812 12:2404030-2404052 TCCCCTAGGCTGGTCACCTCTGG + Intronic
1094524867 12:31224905-31224927 TCCCCAGGGCAGCTCATTGCTGG + Intergenic
1096759597 12:53829515-53829537 TCCCCAAGCCTGCTTTTCTCTGG + Intergenic
1101742235 12:107509641-107509663 TTCCCAAAGGAGCTCATCACTGG + Intronic
1102076235 12:110062399-110062421 TCCCCATGGTTGCTCAACCCAGG - Intronic
1103334955 12:120182450-120182472 TTCCTAAGGCCGGTCATCACTGG + Intronic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1113575807 13:111394626-111394648 TCCCCAAGCCTGCAAACCACTGG - Intergenic
1113722739 13:112572960-112572982 TCCACAAGGAAGCTCAGCACTGG + Intronic
1113950439 13:114068553-114068575 TCCCCAAGGCTGCGCTGCAGTGG - Intronic
1115918452 14:38343389-38343411 TACCCAAGCCTGCACAGCACTGG - Intergenic
1122218710 14:100221656-100221678 CCCCAAAGGCTGCTCTTAACTGG + Intergenic
1122743050 14:103882797-103882819 TCCCCAGGGCTGGTCCTCACAGG - Intergenic
1125103399 15:35942205-35942227 TATCCCAGGCTGCTCATCACTGG + Intergenic
1127462890 15:59215883-59215905 TGCCCAAGGCTGGTCAGCAAGGG - Intronic
1128847877 15:70917418-70917440 TCCCAATGTCTGCTCAGCACTGG - Intronic
1129071222 15:72953094-72953116 TCCCAAAGGCTGATCCTCCCAGG + Intergenic
1129748961 15:78046878-78046900 TCTCCAAGCCTGCGCAGCACAGG - Intronic
1132626846 16:895305-895327 TCCCCAGGTCAGCCCATCACGGG + Intronic
1132654858 16:1037466-1037488 TGCCCCAGGCTGCTCATCGGGGG + Intergenic
1132719122 16:1307364-1307386 TCCCCACGGCTGCGCCTCCCAGG + Intergenic
1132981250 16:2739658-2739680 TCCCCAAGGCCCCTCACCCCAGG + Intergenic
1133210714 16:4262024-4262046 CCCCCAAAGCTGCCCAACACAGG + Intronic
1136249077 16:28991868-28991890 ATCCCAGGGCTGCTCCTCACTGG - Intergenic
1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG + Intergenic
1140232944 16:73133007-73133029 TTGCCAAGGTTGCTCATCACTGG - Intronic
1141676598 16:85521010-85521032 TCCCAAAGGCTCCTCAACCCCGG - Intergenic
1143968886 17:10778056-10778078 CCACCAAGTCTGCTCATCTCTGG + Intergenic
1144341634 17:14314870-14314892 TCCCCAATCCAGTTCATCACGGG + Intronic
1144503327 17:15808203-15808225 GCCCCAAGGCTCCTAATGACTGG + Intergenic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1145165507 17:20610910-20610932 GCCCCAAGGCTCCTAATGACTGG + Intergenic
1148913325 17:50954910-50954932 ACCCGAAGGCTGCTCACCAGAGG + Intergenic
1148954297 17:51341170-51341192 TCCCCAAAGTTGCTCAGCTCAGG + Intergenic
1149664920 17:58358585-58358607 TCCCCAGAGCTGCACATCCCCGG - Exonic
1149689035 17:58558275-58558297 TTCCCACTGCTGCTAATCACTGG - Intronic
1152449273 17:80366086-80366108 TCCCAAGGGCTGCTCTTCAGCGG - Intronic
1156094354 18:33510956-33510978 ACCTGAAGGCTGCACATCACTGG - Intergenic
1156900696 18:42297571-42297593 CCTCCAAGACAGCTCATCACTGG + Intergenic
1157335273 18:46733151-46733173 CCCCGAAGGCGGCTCAACACTGG + Intronic
1159215540 18:65386837-65386859 ACCCCTAGGCTGCACATCGCAGG - Intergenic
1161544652 19:4872972-4872994 TCTCCAGGGCTGCCCAGCACAGG - Intergenic
1163149375 19:15401942-15401964 CGCCCAAGGCTGCTCCTCACAGG + Intronic
1164861264 19:31564024-31564046 TGCCCATGGGTGCTCAGCACAGG - Intergenic
1166796650 19:45430172-45430194 TCCCCAGCGCTGCCCAGCACAGG + Intronic
1168111160 19:54191926-54191948 TCCCGAAGCCTGGCCATCACTGG - Exonic
925892340 2:8445811-8445833 TCCCCTTGGCTGCTCATTGCTGG + Intergenic
926243481 2:11105194-11105216 TTCCCAAGGCTGCTCATCAATGG - Intergenic
927827168 2:26316929-26316951 TCCCCAAGGCCTCTTCTCACTGG - Exonic
927880611 2:26687631-26687653 TACACAAGGATGCTCATCACAGG + Intergenic
930021014 2:47002256-47002278 ACCCCAAGGCTGCCCAGCGCTGG - Intronic
932581349 2:72994575-72994597 TCCCCCAGGCAGCTCCTGACTGG + Intronic
932891512 2:75600975-75600997 TCCTCAAGGCTTCTCTTCTCAGG + Intergenic
933219986 2:79677289-79677311 TCCCCAACCCTCCTCCTCACAGG - Intronic
933258693 2:80108193-80108215 TACCCAAGGCTGCTCCCCTCTGG - Intronic
933816659 2:86074125-86074147 TGCCCATCACTGCTCATCACAGG - Intronic
935078492 2:99769862-99769884 AGCCCCAGGCTGCTCAGCACAGG - Intronic
935680870 2:105635955-105635977 TCCCCCAGGGTTGTCATCACAGG - Intergenic
936944074 2:117914940-117914962 TCCCCAAAACTGGTCATAACTGG + Intergenic
937307708 2:120882284-120882306 TCTCCAGGGCAGCTCACCACAGG + Intronic
938188111 2:129251492-129251514 GCCACAAGGCTGCTCAGCCCCGG - Intergenic
938236720 2:129711482-129711504 TCCCCGAGTTTGCTCATCAAGGG + Intergenic
938307857 2:130266953-130266975 CCCCCAAGGATGCACAGCACTGG - Intergenic
938447480 2:131389888-131389910 CCCCCAAGGATGCACAGCACTGG + Intergenic
946431878 2:219630640-219630662 TCCCCAAGGCCCCTCTTCTCGGG + Intronic
948663696 2:239521707-239521729 CCCCCAAGTCTTCTAATCACTGG - Intergenic
1168852137 20:984373-984395 GCCCCAAGTCTTCTCAGCACTGG - Intronic
1169074556 20:2752729-2752751 ACCCCTAGGCTGCACATCCCGGG + Intronic
1169553355 20:6724075-6724097 TCCTCAAGGCAGCGCATCAGAGG - Intergenic
1171255419 20:23686227-23686249 TTGCCCAGGCTGCTCCTCACAGG - Intronic
1172966390 20:38838505-38838527 TCACCCAGGCTGCTCACCCCAGG - Intronic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1175041859 20:56059547-56059569 TCCCTATGGCTGCTCCTCATTGG - Intergenic
1177609780 21:23431871-23431893 TCTTCAAGGCCTCTCATCACAGG + Intergenic
1178352852 21:31885335-31885357 CCACCAAGGCTGCTCCTCAGAGG - Intronic
1179260300 21:39751806-39751828 TCCCTAAGGCTTCTCATTAGAGG - Intronic
1180008743 21:45035509-45035531 TACCCAAGGCAGCTCTTCCCTGG + Intergenic
1180087573 21:45514857-45514879 CCCCCAAGGCTGCCCAGCCCAGG + Exonic
1180713414 22:17855502-17855524 TCCCCAATCCTCCACATCACTGG + Intronic
1181508865 22:23379924-23379946 TCCCTGAGGCTGCTGGTCACAGG - Intergenic
1181613434 22:24035313-24035335 GTCCCAAGGCAGCTCTTCACTGG + Intronic
1182712564 22:32331970-32331992 TCTCCCAGGCTGCTCAGCCCAGG + Intergenic
1183230612 22:36579698-36579720 TCCCCTCGTCTGCTTATCACAGG + Intronic
1183536028 22:38401933-38401955 TCGGCAGGGATGCTCATCACTGG - Intergenic
1183632056 22:39039597-39039619 TCCCAGAGGCTGCTCTTCCCAGG + Intergenic
1183722811 22:39572236-39572258 TCCCCAAGCCTCCTCCTCAGTGG - Intronic
1185182270 22:49370156-49370178 TCCCCAGGGCCTCTCATCCCAGG - Intergenic
949402989 3:3684673-3684695 GCAGCAGGGCTGCTCATCACTGG - Intergenic
952102550 3:30031631-30031653 GACCCAAGGCTGCTTATTACAGG + Intergenic
952440119 3:33318140-33318162 TCCCCATGGCTGTTTCTCACTGG + Intronic
956757551 3:72403980-72404002 TCCCCAAAGTTGTGCATCACAGG + Intronic
957378201 3:79388388-79388410 TCCCCAGGGGTGCTGATTACAGG - Intronic
968135977 3:196219927-196219949 ACCCCAAGGCTGTTCAGAACAGG + Intronic
968604254 4:1524342-1524364 TCCTCCTGGCTTCTCATCACTGG + Intergenic
968604269 4:1524435-1524457 TCCTCCCGGCTTCTCATCACTGG + Intergenic
968604285 4:1524528-1524550 TCCTCCCGGCTTCTCATCACTGG + Intergenic
968883283 4:3312597-3312619 TTGCTGAGGCTGCTCATCACTGG - Intronic
969535559 4:7754557-7754579 TCCCCAAGGTGCCTCATTACAGG + Intergenic
969722829 4:8902377-8902399 TGCACAAGGCTACTCATGACAGG + Intergenic
971011147 4:22436850-22436872 TTACCATGGATGCTCATCACAGG + Intronic
974593167 4:63982777-63982799 TCCCGAAGGCAGCACAGCACTGG + Intergenic
980729792 4:136811489-136811511 TCCCCTCGTCTGCTCATCCCTGG + Intergenic
981525762 4:145705685-145705707 ACCCCTAGACTGCTCATCACTGG - Intronic
984235974 4:177159548-177159570 TGCACAAGGCTGCTGAGCACTGG + Intergenic
985653836 5:1119808-1119830 CCCCCCAGCCTGCCCATCACAGG - Intergenic
987644386 5:20649289-20649311 ACTTCCAGGCTGCTCATCACAGG - Intergenic
988509713 5:31854943-31854965 TCCCGAAGGCTGCTCTCCGCCGG - Intronic
988726386 5:33930466-33930488 TCCCCAAGGTTGCAAACCACTGG - Intergenic
989806270 5:45611088-45611110 TCACCAAGGCTGCAGAGCACTGG + Intronic
991943497 5:71877667-71877689 TCCACAAGGCTGCTCACCAAAGG + Intergenic
995424921 5:112010303-112010325 TCTCCAAGGCTGCAAATGACAGG + Intergenic
998481868 5:142469668-142469690 TCCCCCAGCCTCCTCAACACAGG - Intergenic
999309315 5:150541630-150541652 TTCCCAAAGCTCCTCATCATCGG + Exonic
1001416125 5:171545737-171545759 TCCCCAAGGCCGCTCAACAAGGG - Intergenic
1004493001 6:16135003-16135025 TCCCTACAGCTGCTCAACACTGG - Intronic
1006042029 6:31264299-31264321 TCCCTAAGTCTGCTAAACACAGG + Intergenic
1006251951 6:32795065-32795087 CCCCAAGGGCTGCTCCTCACCGG + Intergenic
1010735247 6:79436772-79436794 TCCTCAAGGCTGCTCACCATAGG - Intergenic
1014609451 6:123523119-123523141 TCCCCACTGCTGTTCTTCACTGG - Intronic
1016777755 6:147923813-147923835 TCCTCAAGGATGCCCATCCCAGG + Intergenic
1019079366 6:169419762-169419784 TCCCCAAGGTTCGTCTTCACGGG + Intergenic
1020677335 7:11197546-11197568 TCCCCAAGGCTCCACCTCAGTGG - Intergenic
1024392903 7:48835697-48835719 TCTTCAAGGCTGCTCGCCACGGG - Intergenic
1025034821 7:55587523-55587545 CCCCCAAGGATGCACAGCACTGG - Intergenic
1026455809 7:70571694-70571716 TCCCCAAGGCTCCTCCACAGAGG - Intronic
1026455854 7:70571920-70571942 ACCCCAAAGCTGCTCTGCACCGG - Intronic
1031375385 7:121018420-121018442 TCCCCCAGGCTGCTCAACTTGGG - Intronic
1032975534 7:137218453-137218475 TCCCCCAGGCTTTTGATCACCGG + Intergenic
1035110207 7:156475556-156475578 TCCCCAAGGCAGCTGGTCACTGG + Intergenic
1036759411 8:11496937-11496959 TCCCCAAGGCTGCAGACCCCAGG - Intronic
1036991270 8:13598310-13598332 TGTCCCAGGCTGCTCAGCACAGG - Intergenic
1037762553 8:21751519-21751541 TGCCCAAGGTTGCCCAGCACAGG + Intronic
1038403658 8:27305741-27305763 TGCACAAGGCAGCTCAGCACAGG + Intronic
1038986021 8:32811301-32811323 TCCACAAGACTGCTCTGCACTGG + Intergenic
1042225698 8:66512902-66512924 TCCTCCAGGCTCCTCAGCACAGG - Intronic
1045297375 8:100883831-100883853 TGCTCAAGGCTGCTCCACACCGG + Intergenic
1047222119 8:122927057-122927079 ACCACAATGCTGCCCATCACAGG + Intronic
1048549680 8:135422587-135422609 TTCCCAAGGCTTATCATCAGAGG - Intergenic
1049211667 8:141389455-141389477 TCCCCAAGCCTGTTCATGCCCGG + Intergenic
1049562090 8:143317000-143317022 TCCCCAGGGCAGCACAGCACCGG + Intronic
1049979871 9:894127-894149 CCCCGAAGGCTGTTCTTCACAGG - Exonic
1051026202 9:12614687-12614709 TACCCAGGGCTGCTTATCACAGG - Intergenic
1052865851 9:33464242-33464264 CCCCAACGGCTGCTCATCACAGG + Intronic
1055585771 9:77758281-77758303 TCCTCAAGGTTACTCAACACAGG + Intronic
1057184908 9:93051999-93052021 TTCCCAGGCCGGCTCATCACAGG - Intergenic
1058828593 9:108796072-108796094 TCCCCAGGGATGCTGGTCACTGG + Intergenic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1060232224 9:121834148-121834170 ACTCCAAGGCGGTTCATCACAGG + Intronic
1061620843 9:131810399-131810421 TTCCCCAGGCTGTTCATCGCTGG + Intergenic
1186703878 X:12121771-12121793 TCTCCAAGGTTACTCATCTCTGG + Intergenic
1188274061 X:28178493-28178515 TCCCATAGGCTTCTAATCACTGG - Intergenic
1188752347 X:33919906-33919928 ACCCCTAGGCTGCCCATCAGTGG - Intergenic
1189152882 X:38725986-38726008 TTCCCAAGGCTGCACCTCATTGG - Intergenic
1192539846 X:71958504-71958526 TCCCCACTGCTGCTCAGCAATGG - Intergenic
1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG + Intronic
1198321391 X:135521515-135521537 TCCCCGGGGCTGCTCCTCCCCGG - Intronic
1200134201 X:153867022-153867044 TCCCCCAGGCAGCTCAGCCCAGG + Intronic
1201569583 Y:15399728-15399750 CCCTCAAGGCTGCTGGTCACTGG - Intergenic
1201894250 Y:18976806-18976828 TCCCCCAGGCTGGTCTTCAATGG - Intergenic