ID: 1059393018

View in Genome Browser
Species Human (GRCh38)
Location 9:114011114-114011136
Sequence GCAGCTATTAAGTGTCGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059393018 Original CRISPR GCAGCTATTAAGTGTCGAGC TGG (reversed) Intronic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911392049 1:97257765-97257787 GCAGCTATTATGTTTGGAGCTGG + Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
921347281 1:214199439-214199461 GCAGCTACTAAGTGACTAGTTGG - Intergenic
1067744147 10:48922314-48922336 ACAGCTACTAAGTGACGAACAGG - Intronic
1069950656 10:72016092-72016114 GCAGGTAGTAAGTGCCCAGCAGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1081396952 11:42597390-42597412 GCAGCAATTAAGTGACAATCAGG + Intergenic
1088024550 11:105162124-105162146 GAAGCTCTTCAGTGTCAAGCAGG + Intergenic
1090962417 11:131568855-131568877 GGAGCTATTAAGTATACAGCTGG - Intronic
1092524552 12:9301777-9301799 GCAGCTCATGAGTGTGGAGCTGG + Intergenic
1092542713 12:9430035-9430057 GCAGCTCATGAGTGTGGAGCTGG - Intergenic
1094510298 12:31092393-31092415 GCAGCTCATGAGTGTGGAGCTGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1104800125 12:131548914-131548936 GCAGCTACTAAGTGGCCAGTGGG + Intergenic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1110101188 13:71605955-71605977 GCAGCTATCATGTGTTGAACTGG + Intronic
1118474161 14:66101550-66101572 GAAGCTATTCAGTGTCCAGGAGG + Intergenic
1129338691 15:74870907-74870929 GCAGCTTTTAAGTTTCCTGCAGG - Intronic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1144414577 17:15034187-15034209 GCTGCTATTAAGAGGCGTGCTGG - Intergenic
1146892517 17:36515102-36515124 GCAGCTATTACCTGTTCAGCTGG + Exonic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148879245 17:50713073-50713095 GCAGCTATTAATAGACTAGCAGG + Intergenic
1155998090 18:32353366-32353388 GCAGCTACTCAATGTCTAGCTGG + Intronic
1164676831 19:30106774-30106796 GCAGCTCTCAAGTGTCCATCTGG + Intergenic
1167198931 19:48050512-48050534 GCTGCTGTTAAGTTTTGAGCAGG - Intronic
927078675 2:19605889-19605911 CCTGCTATTAAATGTCTAGCAGG + Intergenic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
932389990 2:71379443-71379465 ACAGCTATTAAGTGACTAGTGGG - Intronic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
938865774 2:135418552-135418574 GGAGCTATTAAGTTTGGATCTGG + Intronic
941188193 2:162343929-162343951 GGAGCCAGTAAGAGTCGAGCAGG + Intronic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
949926264 3:9044329-9044351 GCAGCTACTAAGTGGCCAGTGGG + Intronic
951745443 3:25972738-25972760 TCAGCTACTAAGTGACTAGCGGG - Intergenic
954946072 3:54425383-54425405 GCAGCTATTAAATGGCTACCTGG - Intronic
955701149 3:61683496-61683518 GGAGCTGTTAAGTGTAGAGAGGG - Intronic
960961292 3:123072234-123072256 GCAGCTCCTGAGTGTCTAGCTGG - Intronic
966659003 3:182393235-182393257 GCACCTATTAGGTGCCAAGCAGG + Intergenic
967517389 3:190386481-190386503 GCAGCTATTAAGTGACTAAGGGG + Intronic
998003302 5:138641055-138641077 GCAGCTATGAAGTGTTGACAGGG + Intronic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999346249 5:150822191-150822213 GCAGCTACTAAGTGACTAACAGG + Intergenic
999539576 5:152556910-152556932 GCAGCTATTTGGAGCCGAGCAGG - Intergenic
1004473629 6:15950961-15950983 ACAGCTATTAAGTGGTGTGCTGG + Intergenic
1004595276 6:17093800-17093822 GCACCTATTAAGTGCTCAGCTGG - Intergenic
1006078356 6:31548780-31548802 GTAGCTATGAAGTGTGGAGCTGG - Intronic
1007448059 6:41921887-41921909 GCAGCTAAAAAGTGTCTGGCAGG + Intronic
1008518200 6:52338117-52338139 GCAGCCATTGAGTGTCGTGTAGG - Intergenic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1017569384 6:155727330-155727352 GCAGCTATTCAGAGTCCAGAGGG + Intergenic
1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG + Intronic
1022483645 7:30760759-30760781 GTAGCTATTAAGTAGAGAGCTGG + Intronic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1029477511 7:100793816-100793838 GCAGCCATGGAGTGTCCAGCAGG + Exonic
1030008274 7:105139856-105139878 ACAGTTATTAAGTTTTGAGCTGG + Intronic
1033502728 7:141968542-141968564 GCAGCAAAGAAGTGTTGAGCAGG + Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1037348587 8:17924716-17924738 ACAGCTTTGAAGTGTGGAGCGGG + Exonic
1037527589 8:19741954-19741976 GCAGCTGTTCAGGGTTGAGCAGG - Intronic
1039799617 8:40942760-40942782 ACAGTTGTTAAGTGTAGAGCTGG - Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1044804981 8:95996919-95996941 TAAGCTACTAAGTGTTGAGCCGG + Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1049061359 8:140278578-140278600 GCAGCTGTGAAGTGTGCAGCAGG - Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060837892 9:126770963-126770985 ACAGCTAATAAATGTGGAGCTGG - Intergenic
1196991962 X:121339713-121339735 ACAGCTATTAAGTGCAGAGTTGG + Intergenic