ID: 1059393724

View in Genome Browser
Species Human (GRCh38)
Location 9:114017465-114017487
Sequence AAATATCCAGAAAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1585
Summary {0: 1, 1: 0, 2: 6, 3: 56, 4: 1522}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059393724_1059393736 21 Left 1059393724 9:114017465-114017487 CCCAGCTCCTTTTCTGGATATTT 0: 1
1: 0
2: 6
3: 56
4: 1522
Right 1059393736 9:114017509-114017531 CCCCGAGTATATGAGCTAGGGGG No data
1059393724_1059393734 20 Left 1059393724 9:114017465-114017487 CCCAGCTCCTTTTCTGGATATTT 0: 1
1: 0
2: 6
3: 56
4: 1522
Right 1059393734 9:114017508-114017530 TCCCCGAGTATATGAGCTAGGGG No data
1059393724_1059393733 19 Left 1059393724 9:114017465-114017487 CCCAGCTCCTTTTCTGGATATTT 0: 1
1: 0
2: 6
3: 56
4: 1522
Right 1059393733 9:114017507-114017529 ATCCCCGAGTATATGAGCTAGGG No data
1059393724_1059393732 18 Left 1059393724 9:114017465-114017487 CCCAGCTCCTTTTCTGGATATTT 0: 1
1: 0
2: 6
3: 56
4: 1522
Right 1059393732 9:114017506-114017528 GATCCCCGAGTATATGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059393724 Original CRISPR AAATATCCAGAAAAGGAGCT GGG (reversed) Intronic
900835130 1:4997423-4997445 AAAAATACAGAAAATTAGCTGGG - Intergenic
901471442 1:9459488-9459510 AAATATGCAAAAAATTAGCTAGG + Intergenic
901499544 1:9643247-9643269 AAATATACAAAAAATTAGCTGGG + Intergenic
901604500 1:10448757-10448779 AAAAATACAGAAAATTAGCTGGG + Intronic
901755162 1:11437009-11437031 AAATTTCCAGAAGTGGAGGTGGG + Intergenic
901793661 1:11667929-11667951 AAAAATACAGAAAATTAGCTGGG + Intronic
902134905 1:14296794-14296816 AAAAATACAAAAAAGTAGCTAGG - Intergenic
902166860 1:14579462-14579484 AAAAATACAAAAAAGCAGCTGGG + Intergenic
902201142 1:14834520-14834542 AAATATACAGAAAATCAGCTGGG - Intronic
902321811 1:15673039-15673061 AAAAATACAAAAAATGAGCTGGG - Intergenic
902605603 1:17567525-17567547 AAAAATACAAAAAAGGAGCTGGG - Intronic
902812047 1:18893661-18893683 AAAAATACAAAAAATGAGCTGGG - Intronic
902878509 1:19355332-19355354 AAAAATACAAAAAATGAGCTGGG + Intronic
903168833 1:21539813-21539835 AAATATACAAAAAATTAGCTGGG - Intronic
903305605 1:22410738-22410760 AAAAATACAGAAAACTAGCTGGG + Intergenic
903728578 1:25471834-25471856 AAATACCAAGAAAAGGGGTTTGG - Intronic
903785261 1:25856952-25856974 AAAAATACAAAAAATGAGCTGGG + Intronic
903819120 1:26087701-26087723 AAATATACAAAAAATTAGCTGGG + Intergenic
903870564 1:26431540-26431562 AAAAATACAGAAAATGAGCCGGG - Intergenic
903961849 1:27062930-27062952 ACATTTCCAGAAAAGCAGCCTGG - Intergenic
904137827 1:28327759-28327781 AAAAATACAGAAAATTAGCTGGG - Intergenic
904147952 1:28410125-28410147 AAAAATACAAAAAATGAGCTGGG - Intronic
904215636 1:28916474-28916496 AAAAATGCAAAAAAGTAGCTGGG + Intronic
904226127 1:29021741-29021763 AAATATACAAAAAATTAGCTAGG - Intronic
904240491 1:29141486-29141508 AAAAATACAAAAAAGTAGCTAGG - Intergenic
904538073 1:31214476-31214498 AAAAAACCAGAAACGGATCTTGG + Intronic
904571460 1:31469202-31469224 AAAAATACAAAAAACGAGCTGGG - Intergenic
904726437 1:32551866-32551888 AAGTATAAAGAAGAGGAGCTGGG - Intronic
904739654 1:32663735-32663757 AAAAATACAGAAAATTAGCTGGG - Intronic
904754964 1:32763544-32763566 AAATAAACAGAAAAGGACATTGG - Intronic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
905066580 1:35189787-35189809 AAATATACAAAAAATTAGCTGGG + Intronic
905142233 1:35856669-35856691 AAAAATACAGAAAATTAGCTGGG + Exonic
905459053 1:38109662-38109684 AAAAATCCAAAAAATTAGCTGGG - Intergenic
905609512 1:39337928-39337950 AAATATACAAAAAATTAGCTGGG - Intronic
905634743 1:39542570-39542592 AAAAATACAGAAAATTAGCTCGG + Intergenic
906007432 1:42488105-42488127 AAATATATACAAAAGTAGCTAGG - Intronic
906040004 1:42781402-42781424 AAAAATACAGAAAATTAGCTGGG + Intronic
906400945 1:45504253-45504275 AAAAATACAGAAAATGAGCCAGG + Intronic
906423507 1:45689675-45689697 AAAAATACAAAAAATGAGCTGGG + Intronic
906629314 1:47351974-47351996 AAAAATACAAAAAATGAGCTGGG + Intronic
906720607 1:48001432-48001454 AAAGAGCCAGAAAAAGGGCTGGG + Intergenic
907121474 1:52011740-52011762 AAATATCCTGATAGGCAGCTGGG + Intergenic
907215782 1:52862470-52862492 AAAAATACAAAAAAGTAGCTGGG - Intronic
907690464 1:56659334-56659356 AAAAATACAAAAAATGAGCTGGG + Intronic
908194950 1:61739326-61739348 GAATAGCAAGAAAAGGAGTTTGG + Intergenic
908216864 1:61962927-61962949 AAATATCCTTAAAAGGAGGAAGG - Intronic
908229913 1:62093506-62093528 CAATAACAATAAAAGGAGCTTGG - Intronic
908296728 1:62720059-62720081 AAAAATCAAGAAAATTAGCTGGG + Intergenic
908662009 1:66446907-66446929 AAATGTCCACATCAGGAGCTTGG - Intergenic
908695072 1:66830618-66830640 AAAAATTCAAAAAAGTAGCTGGG + Intronic
908736171 1:67279125-67279147 AAAAATACAGAAAAGTAGCCAGG + Intergenic
908895816 1:68897200-68897222 AAATAGCCAGAAAGCCAGCTGGG - Intergenic
909221762 1:72972124-72972146 AAAAATGCAGAAAAATAGCTGGG - Intergenic
909503081 1:76357293-76357315 AAAAATACAAAAAAGTAGCTGGG - Intronic
909519209 1:76547691-76547713 AAAAATACAAAAAAGTAGCTGGG + Intronic
910088782 1:83436850-83436872 AAAAATACAAAAAAGTAGCTGGG - Intergenic
910252427 1:85211718-85211740 AAAAATACAGAAAATTAGCTGGG - Intergenic
910277924 1:85467884-85467906 AGACATCCAGAATTGGAGCTGGG + Intronic
910553341 1:88501255-88501277 AATTATCCAGGGAAGGAACTGGG + Intergenic
910619935 1:89242472-89242494 AAAAATACAGAAAATTAGCTGGG - Intergenic
910918476 1:92317345-92317367 AAAAATACAAAAAATGAGCTGGG + Intronic
911001249 1:93168672-93168694 AAAAATACAAAAAATGAGCTGGG + Intronic
911205311 1:95086544-95086566 AAATAACCAGGAAAGAGGCTGGG + Intergenic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
911539386 1:99140161-99140183 AAATATACAAAAAATTAGCTGGG - Intergenic
911923011 1:103791077-103791099 AAAAATACAAAAAAGTAGCTGGG + Intergenic
912063198 1:105700255-105700277 AAATATACAAAAAACTAGCTGGG - Intergenic
912163735 1:107017834-107017856 AAAAATGCAGAAAATGAGCTGGG - Intergenic
912780530 1:112542958-112542980 AAAAATACAAAAAAGTAGCTGGG - Intronic
912843310 1:113058406-113058428 AAAGATACAAAAAAGTAGCTGGG - Intergenic
912878704 1:113388781-113388803 AAACACCCAGCAAAGGACCTGGG - Intergenic
913008261 1:114656555-114656577 AAAAATACAAAAAATGAGCTGGG - Intronic
913242339 1:116839990-116840012 AAATATACAAAAAATTAGCTAGG + Intergenic
914095870 1:144544020-144544042 AAAAATACAAAAAAGTAGCTGGG - Intergenic
914228872 1:145746063-145746085 AAATATACAAAAAATTAGCTGGG + Exonic
914302653 1:146389945-146389967 AAAAATACAAAAAAGTAGCTGGG + Intergenic
914315189 1:146504166-146504188 AAATATACAAAAAATTAGCTGGG + Intergenic
914438983 1:147686099-147686121 AAAAATACAAAAAAGTAGCTGGG + Intergenic
914499165 1:148229210-148229232 AAATATACAAAAAATTAGCTGGG - Intergenic
914795384 1:150915780-150915802 AAAAATACAGAAAATTAGCTGGG + Intergenic
915089935 1:153417159-153417181 AAAGAACCAGAAAAGGACCTTGG - Intronic
915095546 1:153459916-153459938 AAAGAACCAGGAAAGGACCTTGG + Intronic
915114929 1:153591523-153591545 AAATATACAAAAAATTAGCTGGG + Intergenic
915207559 1:154281721-154281743 AAATATACAAAAAATTAGCTGGG + Intergenic
915266919 1:154725702-154725724 AAAAATACAGAAAATTAGCTGGG - Intronic
915330904 1:155111839-155111861 AAAAATACAGAAAATTAGCTGGG - Intergenic
915381163 1:155441924-155441946 AAAAATACAAAAAAGTAGCTGGG - Intronic
915384923 1:155481842-155481864 AAAGATTCAGGAAAGAAGCTAGG - Exonic
915398172 1:155601913-155601935 AAATATACAAAAAATTAGCTGGG - Intergenic
915502595 1:156329464-156329486 AAAAATACAAAAAATGAGCTGGG - Intronic
915919528 1:159963897-159963919 AAATATACAAAAAATTAGCTGGG + Intergenic
916178293 1:162061473-162061495 AAAAATACAAAAAAGTAGCTGGG - Intergenic
916224676 1:162477567-162477589 AAAAATACAGAAAATTAGCTGGG + Intergenic
916352665 1:163869457-163869479 AAAAATACAGAAAATTAGCTGGG + Intergenic
916538486 1:165728415-165728437 AAATATACAGAAAATTAGCCGGG - Intronic
916672188 1:167031774-167031796 AAATATAAAAAAAATGAGCTGGG + Intergenic
916864434 1:168840359-168840381 AAAAATACAAAAAATGAGCTGGG - Intergenic
916886589 1:169074560-169074582 AAAAATACAAAAAATGAGCTGGG + Intergenic
916936214 1:169630811-169630833 AGATAGCCAGAAGAGGAGCCAGG - Intergenic
917150982 1:171944532-171944554 AAAAATACAGAAAATTAGCTGGG - Intronic
917361496 1:174181496-174181518 AAAAATACAAAAAATGAGCTGGG - Intronic
917471727 1:175331422-175331444 AAAAATACAAAAAATGAGCTGGG - Intronic
917643370 1:177005766-177005788 AAAAATACAGAAAATTAGCTGGG - Intronic
917871334 1:179244637-179244659 AAATATACAAAAAAGTAGCCGGG - Intergenic
917875492 1:179283093-179283115 AAAAATACAAAAAATGAGCTGGG - Intergenic
917895860 1:179485956-179485978 AAAAATACAGAAAATTAGCTAGG + Intronic
917938630 1:179894088-179894110 AAAAATACAAAAAAGTAGCTGGG + Intronic
918246284 1:182662484-182662506 AGATATCCAGTAATAGAGCTGGG + Intronic
918455776 1:184712085-184712107 AAATATACAAAAAATTAGCTGGG - Intronic
918521797 1:185423178-185423200 AAATGTCCAGAAACAGAGGTTGG - Intergenic
919216799 1:194567071-194567093 AAATATACAAAAAATTAGCTGGG - Intergenic
919264757 1:195248485-195248507 AAAAATACAAAAAATGAGCTGGG + Intergenic
919339318 1:196283278-196283300 AAAAATACAGAAAATTAGCTGGG + Intronic
919809901 1:201402330-201402352 AAAAATACAAAAAATGAGCTGGG + Intergenic
920025688 1:202993634-202993656 AAAAATACAGAAAATTAGCTGGG - Intergenic
920046054 1:203133272-203133294 AAAAATACAAAAAATGAGCTGGG - Intronic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
921016063 1:211191972-211191994 AAAAATACAGAAAATTAGCTGGG + Intergenic
921029122 1:211321903-211321925 AAAAATACAAAAAAGTAGCTGGG - Intergenic
921441103 1:215187128-215187150 AAAAATACAGAAAATTAGCTGGG - Intronic
921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG + Intronic
922127305 1:222740858-222740880 AAATATACAAAAAATTAGCTGGG - Intronic
922588771 1:226756427-226756449 AAATATTCAGTAAACCAGCTGGG - Intergenic
922972866 1:229757915-229757937 AAATCTCCAGAAAAGGTACAGGG - Intergenic
923150376 1:231227747-231227769 AAAAATACAAAAAAGTAGCTGGG - Intronic
923473553 1:234313034-234313056 AAATATGCAAAAAATTAGCTGGG - Intronic
923599971 1:235394233-235394255 AAATATACAAAAAAGTAGCTGGG - Intronic
923659661 1:235947106-235947128 AAATATACAAAAAATTAGCTGGG + Intergenic
923666267 1:236001264-236001286 AAAAATACAGAAAATTAGCTGGG - Intronic
923695190 1:236241905-236241927 AAATATACAAAAAATTAGCTGGG + Intronic
923738798 1:236636573-236636595 AAAAATACAGAAAATTAGCTGGG - Intergenic
923908935 1:238417779-238417801 AAATGATCAGAATAGGAGCTTGG - Intergenic
924105602 1:240646018-240646040 AAAAATACAAAAAATGAGCTGGG + Intergenic
924396338 1:243625290-243625312 AAAAATACAGAAAATTAGCTTGG - Intronic
924717631 1:246592325-246592347 AAAAATACAAAAAATGAGCTGGG + Intronic
924751912 1:246901461-246901483 AAATATACAAAAAATTAGCTGGG + Intronic
924855784 1:247873807-247873829 AAAAATACAGAAAACTAGCTGGG + Intronic
1063238714 10:4146212-4146234 AATTATCCAGACAAGGATCCTGG - Intergenic
1063345808 10:5311424-5311446 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1063586118 10:7353924-7353946 AAATATACAAAAAATTAGCTGGG + Intronic
1063649028 10:7915099-7915121 AAAAATACAAAAAAGTAGCTGGG - Intronic
1063898040 10:10702743-10702765 AAAAATACAGAAAATTAGCTGGG - Intergenic
1064087555 10:12356559-12356581 AAAAATACAGAAAATTAGCTGGG + Intronic
1064376113 10:14797653-14797675 AAATATACAAAAAATTAGCTGGG + Intergenic
1064593884 10:16923384-16923406 AAATGTTCACAAAAGGACCTAGG + Intronic
1065017025 10:21471360-21471382 AAAAATACAAAAAATGAGCTGGG - Intergenic
1065097385 10:22295146-22295168 AAAAATCTAGAAAAGGGGATAGG - Intergenic
1065290685 10:24226479-24226501 AAAAATACAGAAAATTAGCTGGG + Intronic
1065312488 10:24429983-24430005 AAATATACAAAAAATTAGCTGGG + Intronic
1065452855 10:25876880-25876902 AAAAATACAGAAAATTAGCTGGG + Intergenic
1065548686 10:26848038-26848060 AAATACCCAAAAAATTAGCTGGG + Intronic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1065585802 10:27216298-27216320 AAATATACAAAAAATTAGCTGGG - Intronic
1065696204 10:28382399-28382421 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1065706751 10:28477621-28477643 AAATATACAAAAAATTAGCTGGG + Intergenic
1065866062 10:29916460-29916482 AAAAATACAGAAAATTAGCTGGG + Intergenic
1066099318 10:32103627-32103649 AAATATACAAAAAATTAGCTGGG + Intergenic
1066196028 10:33100979-33101001 AAATATTCAGAAAAGCAGAGAGG - Intergenic
1066318619 10:34276625-34276647 ATATATCCAGAAAAGGTACCAGG + Intronic
1066547599 10:36517570-36517592 AAATATACAAAAAATTAGCTGGG - Intergenic
1066557918 10:36635908-36635930 AAAAATACAAAAAATGAGCTGGG - Intergenic
1066621033 10:37350392-37350414 AAATATACAAAAAATTAGCTGGG - Intronic
1067022309 10:42812152-42812174 AACTAGGCAGAAAAGGAGCAAGG - Intronic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1067550291 10:47229577-47229599 AAATAAGCAGAAATGGAGCCAGG + Intergenic
1067714212 10:48674086-48674108 AAATATACAAAAAATTAGCTGGG - Intergenic
1067778915 10:49184489-49184511 AAATCTACAGAAAAGGAGAATGG + Intronic
1067846189 10:49723594-49723616 AAATATACAGAAAAGGAGGCTGG - Intergenic
1067919266 10:50436646-50436668 GAACATTCAGAAAAGGAGCCAGG - Intronic
1068020568 10:51578127-51578149 AAATATCCAGAGAAGAAAATAGG - Intronic
1068199695 10:53766905-53766927 AAAAATACAGAAAATTAGCTGGG + Intergenic
1068674338 10:59754541-59754563 AAAAATACAGAAAAGTAGCCAGG + Intergenic
1068890218 10:62140872-62140894 AAAAATACAAAAAATGAGCTGGG - Intergenic
1068964897 10:62902145-62902167 AAAGATCCAAAAAAAGAGATAGG - Intronic
1069055302 10:63838655-63838677 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1069497627 10:68920320-68920342 AAATACGCAAAAAATGAGCTGGG - Intronic
1069549286 10:69351346-69351368 AAAAATACAAAAAATGAGCTGGG + Intronic
1069955928 10:72051788-72051810 AAATATACAAAAAATTAGCTGGG - Intergenic
1069978376 10:72234165-72234187 AAATATACAAAAAATTAGCTGGG - Exonic
1070034811 10:72711870-72711892 AAAAATACAGAAAATTAGCTGGG - Intronic
1070796126 10:79217457-79217479 CAATATCCAGACACGGTGCTAGG - Intronic
1070911611 10:80123799-80123821 AAATATACAAAAAATTAGCTGGG - Intergenic
1070936553 10:80302621-80302643 AAAAATACAAAAAATGAGCTGGG + Intergenic
1071928333 10:90436952-90436974 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1071932681 10:90490506-90490528 AAATAGCCAGAAAAGGAGACAGG + Intergenic
1072208868 10:93228575-93228597 AAAAATACAGAAAATTAGCTGGG + Intergenic
1072339478 10:94432907-94432929 AAATATCCTTATAAGTAGCTGGG + Intronic
1072645740 10:97251846-97251868 AAATATCCAGAAAGGGCACCAGG + Intronic
1073345428 10:102779456-102779478 AAATACCCAAAAAATTAGCTGGG - Intronic
1073999055 10:109349718-109349740 AAAAATCGAGAAAAGAAACTTGG - Intergenic
1074117672 10:110469462-110469484 AAATACCCAAAAAATTAGCTGGG - Intergenic
1074411397 10:113231576-113231598 AAAAATACAAAAAATGAGCTGGG + Intergenic
1074747781 10:116552723-116552745 AAAAATACAGAAAATTAGCTGGG + Intronic
1074778487 10:116783861-116783883 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1075163518 10:120045201-120045223 AAATATACAGAAAATTAGCTGGG + Intergenic
1075223703 10:120606263-120606285 AAATATCTAGAAAAAGTGCTTGG + Intergenic
1075309240 10:121398124-121398146 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1075448869 10:122533491-122533513 AAATATACAAAAAATCAGCTGGG - Intergenic
1075532256 10:123239577-123239599 AAATATACAAAAAATTAGCTGGG + Intergenic
1075558736 10:123452401-123452423 AAATCTCCAACAAAGGAGCCAGG - Intergenic
1075975907 10:126694750-126694772 AAATATACAAAAAATTAGCTGGG + Intergenic
1076019583 10:127061364-127061386 AAATATACAGAAAGGGAGGGTGG - Intronic
1077254910 11:1576439-1576461 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1077630035 11:3805420-3805442 AAAAATACAGAAAACTAGCTGGG - Intronic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1078225940 11:9391544-9391566 AAAAATACAGAAAATTAGCTGGG + Intronic
1078763661 11:14273007-14273029 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1078859602 11:15235158-15235180 TAGTATCCAGGAAAGAAGCTTGG + Intronic
1079224517 11:18593987-18594009 AAATATACAAAAAATTAGCTGGG - Intergenic
1079934798 11:26603960-26603982 AAATAGCTAGAAAAGAGGCTTGG - Intronic
1079959517 11:26905852-26905874 AAAAATACAGAAAATTAGCTGGG + Intergenic
1080121881 11:28687188-28687210 AAAAATACAGAAAATTAGCTGGG - Intergenic
1080400303 11:31928593-31928615 AAATATACAAAAAATTAGCTGGG + Intronic
1080594445 11:33757795-33757817 AAAAATACAAAAAAGTAGCTGGG + Intronic
1080708213 11:34719556-34719578 AAAGAACCAGGAAAGGAGCCTGG + Intergenic
1080741732 11:35071190-35071212 AAAAATACAAAAAATGAGCTGGG + Intergenic
1081272355 11:41100404-41100426 AAAAATACAAAAAAGTAGCTGGG + Intronic
1081412569 11:42777038-42777060 AAAAATACAAAAAAGTAGCTTGG - Intergenic
1082010269 11:47445433-47445455 AAAAATACAGAAAATTAGCTGGG + Intronic
1082019247 11:47517811-47517833 AAAAATACAAAAAAGTAGCTGGG - Intronic
1082049582 11:47759790-47759812 AAAATTCAAGAAAAGGAGCTGGG + Intronic
1082050058 11:47763659-47763681 AAAAATACAGAAAATTAGCTGGG - Intronic
1082103789 11:48197789-48197811 AAAAATACAGAAAATTAGCTGGG + Intergenic
1082232779 11:49789191-49789213 AAATATCAACAACAGGAGTTTGG - Intergenic
1082629910 11:55529846-55529868 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1082867784 11:57915741-57915763 AAAGATACAAAAAATGAGCTGGG - Intergenic
1082936349 11:58660814-58660836 AAATATACAGAAAATTAGCCGGG + Intronic
1082969646 11:59005808-59005830 AGATAGCCAGAAGAGGAGCCAGG - Intronic
1083210811 11:61184410-61184432 AAATATACAAAAAATCAGCTGGG + Intergenic
1083215267 11:61214761-61214783 AAATATACAAAAAATTAGCTGGG + Intergenic
1083218151 11:61233590-61233612 AAATATACAAAAAATTAGCTGGG + Intergenic
1083696763 11:64448646-64448668 AAAAATTCAGAAAAGGGGCGAGG - Intergenic
1083791828 11:64990714-64990736 AAGTGTCCAGAAAAGGGGGTGGG - Intronic
1083847412 11:65344110-65344132 TCATATCCAGAGCAGGAGCTGGG - Intronic
1083937659 11:65878651-65878673 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1084289031 11:68149990-68150012 AAAAATACAGAAAATTAGCTGGG + Intergenic
1084472939 11:69373800-69373822 AAATATACAAAAAAGTAGCTGGG + Intergenic
1084535747 11:69755652-69755674 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1084917287 11:72438344-72438366 AAAGATCCAAAAAATTAGCTGGG + Intergenic
1084929775 11:72545730-72545752 AAATATACGAAGAAGGAGCTGGG - Intergenic
1085135336 11:74082274-74082296 AAAAATACAGAAAATTAGCTGGG - Intronic
1085443639 11:76584443-76584465 AAAAATACAGAAAATTAGCTGGG + Intergenic
1085538366 11:77241781-77241803 AAAAATACAGAAAATTAGCTGGG + Intronic
1085585142 11:77695688-77695710 CATTATCCAGTAAAGGAGCTAGG - Intronic
1085672370 11:78480057-78480079 AAATATCAAAAAAATTAGCTGGG - Intronic
1085723678 11:78935170-78935192 AAAAATACAGAAAATTAGCTGGG - Intronic
1085879088 11:80444406-80444428 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1086672559 11:89566201-89566223 AAAAATACAGAAAATTAGCTGGG - Intergenic
1087133822 11:94694468-94694490 AAATTTCCATATAAGGAGCCTGG + Intergenic
1087204508 11:95379751-95379773 TAATATCTTGAAAAGCAGCTAGG + Intergenic
1087443235 11:98211544-98211566 AAATATACAAAAAATTAGCTGGG - Intergenic
1087526815 11:99324800-99324822 AAAAATACAAAAAAGTAGCTGGG - Intronic
1087595478 11:100248713-100248735 AAAAAGCCAGAAAAGTTGCTTGG + Intronic
1087827711 11:102785153-102785175 AAAAATACAGAAAATTAGCTGGG - Intergenic
1087851124 11:103030620-103030642 AAATATACAAAAAATAAGCTGGG - Intergenic
1088458221 11:110054740-110054762 AAATATACAGAAGATTAGCTGGG + Intergenic
1088554702 11:111049812-111049834 AAAAATACAGAAAATTAGCTGGG - Intergenic
1088896976 11:114085855-114085877 AAATGTCCAGAAAGCTAGCTTGG - Intronic
1088898446 11:114095419-114095441 AAATATACAAAAAATTAGCTGGG - Intronic
1089087098 11:115829462-115829484 AAAAATACAGAAAATTAGCTGGG + Intergenic
1089265008 11:117252679-117252701 AAAAATACAAAAAATGAGCTGGG - Intronic
1089423967 11:118354461-118354483 AAATACACAAAAAATGAGCTGGG - Exonic
1089552537 11:119291545-119291567 AAAGATACAGAAATGTAGCTGGG + Intronic
1089841761 11:121424844-121424866 AAAAATCAAGAAAATTAGCTGGG + Intergenic
1089883796 11:121800315-121800337 AAATATACCAAAAAGGAACTGGG + Intergenic
1090020584 11:123125055-123125077 AAAAATACAGAAAATTAGCTAGG - Intronic
1090411025 11:126509834-126509856 AAAAATACAGAAAATTAGCTGGG + Intronic
1090658605 11:128864616-128864638 AAGTATACAGAAAAGGGCCTAGG - Intronic
1090763503 11:129857011-129857033 AAAAATACAAAAAATGAGCTGGG - Intronic
1090775074 11:129957476-129957498 AAAAATACAAAAAAGTAGCTGGG - Intronic
1091914442 12:4259635-4259657 AAAAATACAGAAAATTAGCTGGG - Intergenic
1092506155 12:9102373-9102395 AAATATACAAAAAATTAGCTGGG - Intronic
1093444168 12:19235645-19235667 AACTGTTGAGAAAAGGAGCTGGG + Intronic
1093582249 12:20796217-20796239 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1093735514 12:22615683-22615705 AAAAATACAAAAAATGAGCTGGG - Intergenic
1094024560 12:25949061-25949083 AAACATACAGAAAATTAGCTGGG - Intergenic
1094077665 12:26495823-26495845 AAATAGCCAGAAAAAGAGTGGGG + Intronic
1094093539 12:26677437-26677459 AAAAATCCAAAAAATTAGCTGGG + Intronic
1094155038 12:27330378-27330400 AAATATACAAAAAATTAGCTGGG - Intergenic
1094178869 12:27569717-27569739 AAAAATACAAAAAAGTAGCTGGG - Intronic
1094333417 12:29321362-29321384 AAATATACAAAAAATTAGCTGGG + Intronic
1094562567 12:31569226-31569248 AAAAATACAGAAAATTAGCTGGG - Intronic
1094594725 12:31854740-31854762 AAAAATACAGAAAATTAGCTGGG - Intergenic
1095316455 12:40767467-40767489 AAAAATACAGAAAATTAGCTGGG - Intronic
1095497182 12:42797513-42797535 AAATATACAAAAAATTAGCTGGG + Intergenic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1095759032 12:45806716-45806738 AAAAATCCAGTACAGTAGCTTGG - Intronic
1096016796 12:48283530-48283552 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1096129078 12:49143089-49143111 AAATATACAAAAAATTAGCTGGG - Intergenic
1096348798 12:50876641-50876663 AAATATACAAAAAATTAGCTGGG + Intronic
1096462621 12:51830650-51830672 AAAAATACAGAAAATTAGCTGGG - Intergenic
1096990543 12:55798336-55798358 AAAAATACAAAAAAAGAGCTGGG + Intronic
1097063662 12:56304375-56304397 AAATGACCAGAAAGGGGGCTGGG + Intronic
1097359754 12:58645882-58645904 AATTAACCAGACAAGTAGCTGGG + Intronic
1097504398 12:60446754-60446776 GTGCATCCAGAAAAGGAGCTTGG - Intergenic
1097897457 12:64839842-64839864 AAATATACAAAAAATTAGCTGGG + Intronic
1097966935 12:65591233-65591255 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1097980514 12:65733417-65733439 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1097982494 12:65748774-65748796 AAATATACAAAAAATTAGCTGGG + Intergenic
1097984670 12:65770713-65770735 AAAAATACAGAAAATTAGCTGGG + Intergenic
1098190712 12:67945591-67945613 AAAAATACAAAAAATGAGCTGGG - Intergenic
1098406168 12:70128615-70128637 AAACATACAGAAAATTAGCTGGG + Intergenic
1099187583 12:79532789-79532811 AAAAATACAGAAAATTAGCTGGG - Intergenic
1099397355 12:82157541-82157563 AAATACAAAGAAAAGGAGCCAGG + Intergenic
1099452023 12:82819660-82819682 AAAAATACAGAAAATTAGCTGGG - Intronic
1099482130 12:83181041-83181063 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1099776693 12:87141808-87141830 AAATATCAAGAAAAGTGGATAGG + Intergenic
1099885660 12:88527027-88527049 AAAAATACAGAAAATTAGCTGGG - Intronic
1099951847 12:89312503-89312525 AAATATACAAAAAATTAGCTGGG + Intergenic
1100245673 12:92754185-92754207 GAATATCTGGAAAAGGAGCATGG + Exonic
1100824478 12:98461997-98462019 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1100871585 12:98915510-98915532 AAATATGCAAAAAATTAGCTGGG - Intronic
1100882809 12:99037353-99037375 AAAAATACAGAAAACTAGCTGGG + Intronic
1101211922 12:102543418-102543440 AAGTAACCAGAACAGGTGCTTGG - Intergenic
1101354940 12:103967987-103968009 AAATATACAAAAAATTAGCTGGG - Intronic
1101390508 12:104295524-104295546 AGATAACCAGAAAAGCAGGTTGG - Intronic
1101394165 12:104329486-104329508 AAATATACAAAAAATGAGATCGG + Intronic
1101586839 12:106092355-106092377 AAATATACAAAAAATTAGCTGGG + Intronic
1101867511 12:108531783-108531805 ATCTATCCAACAAAGGAGCTTGG - Intronic
1102146278 12:110657332-110657354 AAACATACAGAAAATTAGCTGGG + Intronic
1102481407 12:113226439-113226461 AAAAATACAGAAAATTAGCTGGG - Intronic
1102567954 12:113809359-113809381 AAAAATACAAAAAATGAGCTGGG - Intergenic
1102686887 12:114731937-114731959 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1102700592 12:114835669-114835691 AAAAATACAAAAAATGAGCTAGG + Intergenic
1102740609 12:115204192-115204214 AAATATCCAAAATAGGGGATAGG + Intergenic
1102927056 12:116834276-116834298 AAATATACAAAAAATTAGCTGGG - Intronic
1103044667 12:117726005-117726027 AAATATACAAAAAATTAGCTGGG + Intronic
1103182382 12:118924895-118924917 AAAAATACAAAAAATGAGCTGGG + Intergenic
1103456110 12:121067066-121067088 AAATATACAAAAAATTAGCTGGG + Intergenic
1103483491 12:121266651-121266673 AAATATACAAAAAAGTAGCCAGG - Intronic
1103495345 12:121357742-121357764 AAAAATACAAAAAATGAGCTGGG + Intronic
1104008126 12:124909680-124909702 AAATATACAAAAAAATAGCTGGG - Intergenic
1104075759 12:125388266-125388288 AAAAATACACAAAAGTAGCTGGG + Intronic
1104447867 12:128847394-128847416 AAAAATACAAAAAATGAGCTGGG + Intergenic
1104455404 12:128907464-128907486 AAATATACAAAAAATTAGCTGGG - Intronic
1104603341 12:130168646-130168668 AAAGACCCAGAACAGGAACTGGG + Intergenic
1105291343 13:19055654-19055676 AAATGCCCAGGACAGGAGCTGGG - Intergenic
1105505033 13:21002534-21002556 AAAAATACAGAAAATTAGCTGGG - Intronic
1105716321 13:23068857-23068879 AAAAATACAAAAAAGGAGCCAGG - Intergenic
1105878592 13:24583208-24583230 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1106268863 13:28135166-28135188 AAAAATACAGAAAATTAGCTAGG - Intergenic
1106401750 13:29437785-29437807 AAAAATACAGAAAATTAGCTGGG + Intronic
1106501154 13:30330281-30330303 AAATATACAGAAATGCAGCCCGG - Intergenic
1106723332 13:32458223-32458245 AAAAATACAAAAAAGTAGCTGGG - Intronic
1107445582 13:40467638-40467660 AAAATTCCAGAAAGGAAGCTGGG - Intergenic
1107878555 13:44812833-44812855 AATTATCAAGAAAAAGTGCTTGG + Intergenic
1108191287 13:47941819-47941841 AAAAATACAAAAAATGAGCTGGG + Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108339540 13:49484428-49484450 AAAAATACAAAAAAGTAGCTGGG - Intronic
1108363988 13:49691993-49692015 AAAAATCCAGAAAAGTAGAAGGG + Intergenic
1108559734 13:51630937-51630959 AAAAATACAGAAAATTAGCTGGG - Intronic
1108725488 13:53176020-53176042 AAAAATACAGAAAATTAGCTGGG + Intergenic
1108755385 13:53495180-53495202 AAAAATACAGAAAATTAGCTGGG + Intergenic
1108833675 13:54512320-54512342 AAATATCTAGACAAGGTGATTGG - Intergenic
1108918030 13:55640588-55640610 AAAAATACAGAAAATCAGCTGGG - Intergenic
1109683700 13:65785297-65785319 AAATTTCCAGAAAAGGGGTGGGG - Intergenic
1109761608 13:66837285-66837307 GAACATTCAGAAAAGGACCTGGG - Intronic
1110018151 13:70434688-70434710 AAAAATACAAAAAATGAGCTGGG + Intergenic
1110025870 13:70538633-70538655 AAAAATACAGAAAATTAGCTGGG - Intergenic
1110481767 13:75986370-75986392 AAAGATCCAGGAAAAGAGCATGG - Intergenic
1110694115 13:78467349-78467371 AAATATACAGCAAAGGGGATGGG - Intergenic
1110864291 13:80377159-80377181 AAAAATACAGAAAATTAGCTGGG + Intergenic
1111335971 13:86823730-86823752 ATAGATGCAGAAAAGCAGCTGGG + Intergenic
1111496113 13:89053249-89053271 AAAAATACAAAAAATGAGCTGGG - Intergenic
1111542853 13:89690557-89690579 AAAAATACAAAAAATGAGCTGGG + Intergenic
1111636043 13:90905356-90905378 AAATATCCAGAATGCTAGCTGGG + Intergenic
1111691703 13:91571562-91571584 AAAAATACAAAAAAGTAGCTGGG + Intronic
1112159881 13:96855945-96855967 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1112343765 13:98574170-98574192 AAAAATCCAAAAAATTAGCTGGG - Intronic
1112400042 13:99068422-99068444 AAAAATACAGAAAATTAGCTGGG + Intronic
1112933883 13:104775555-104775577 AAATATACAAAAAAGTAGCCGGG + Intergenic
1112982064 13:105397033-105397055 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1113062177 13:106334288-106334310 AATTATTCAAAAAAGGAGATGGG - Intergenic
1114179548 14:20354289-20354311 AAGTATCCATTAAAGGAGCTAGG - Intronic
1114276095 14:21146410-21146432 AAATATACAAAAAATTAGCTGGG - Intergenic
1114325327 14:21583196-21583218 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1114503020 14:23185802-23185824 TAATATCTAGGAAAGGGGCTGGG + Intronic
1114506694 14:23220662-23220684 AAAAATACAGAAAATTAGCTGGG + Intronic
1115406475 14:33022502-33022524 AAAAATACAAAAAAGTAGCTGGG + Intronic
1115546807 14:34471452-34471474 AAAAATACAGAAAATTAGCTGGG + Intergenic
1115565880 14:34625074-34625096 AAAAATACAGAAAATTAGCTGGG - Intronic
1115586829 14:34822462-34822484 AAAAATACAGAAAATTAGCTGGG + Intronic
1115685052 14:35788130-35788152 AAAAATACAAAAAATGAGCTGGG - Intronic
1116111934 14:40596251-40596273 AAATATACAAAAAATTAGCTGGG - Intergenic
1116221955 14:42098235-42098257 AAATATACAAAAAATTAGCTGGG + Intergenic
1116344351 14:43771882-43771904 AAAAATACAGAAAATGAGCTGGG + Intergenic
1116392322 14:44408018-44408040 ACATAACCAGAAAAGAAGCCGGG + Intergenic
1116402563 14:44526505-44526527 AACTCTTCAGTAAAGGAGCTGGG - Intergenic
1116456081 14:45122662-45122684 AAAAATCCAAAAAATGAGCTGGG - Intronic
1116701086 14:48243131-48243153 AAAGATTCAGAAAAGGAATTAGG - Intergenic
1117054175 14:51894005-51894027 TAATATCTAGAAAAGTAACTGGG + Intronic
1117295296 14:54373520-54373542 AAAAATACAGAAAAATAGCTAGG + Intergenic
1117368527 14:55054302-55054324 AAAAATACAGAAAATTAGCTGGG - Intronic
1117660730 14:58001720-58001742 GAATCTCCAGGGAAGGAGCTTGG - Exonic
1117683416 14:58228459-58228481 AAATATACAAAAAATTAGCTGGG + Intronic
1117791023 14:59342511-59342533 TACTATGCACAAAAGGAGCTGGG + Intronic
1117907756 14:60608311-60608333 AAAAATACAGAAAATTAGCTAGG + Intergenic
1118196355 14:63630345-63630367 AAAAGTCCAGACAAGGGGCTGGG + Intronic
1118228041 14:63921406-63921428 AAATATCTAGAAAAAGAGAAGGG + Intronic
1118461218 14:65988955-65988977 AAAAATACAAAAAAGTAGCTGGG - Intronic
1118625392 14:67654262-67654284 AAAAATCAAAAAAAGGAGCAGGG - Intronic
1118815910 14:69313702-69313724 ACATATCCAGAACACGAGATAGG - Intronic
1118878740 14:69808443-69808465 AAATATGCTGAAAAGTGGCTGGG + Intergenic
1118949160 14:70418372-70418394 AAATATACAAAAAATTAGCTCGG + Intergenic
1119011234 14:70991363-70991385 AAAAATCCAAAAAATTAGCTGGG - Intronic
1119142192 14:72277434-72277456 AAAAATACAAAAAATGAGCTGGG + Intronic
1119245213 14:73098802-73098824 AAAAATACAAAAAAGTAGCTGGG - Intronic
1119280369 14:73401728-73401750 AAAAATACAGAAAATTAGCTGGG - Intronic
1119285223 14:73447955-73447977 AAAAATACAAAAAAGTAGCTGGG - Intronic
1120431517 14:84422583-84422605 AAATATGCAGAAAAGAAGCATGG - Intergenic
1120444400 14:84576199-84576221 AAATATACAAAAAATTAGCTGGG + Intergenic
1120511462 14:85421115-85421137 AAAAATACAGAAAACTAGCTGGG - Intergenic
1120814201 14:88836898-88836920 AAAAATACAGAAAATTAGCTGGG + Intronic
1120822467 14:88925531-88925553 AAATATACTGAAAAGAAGTTGGG - Intergenic
1120971627 14:90212956-90212978 AAATATACAAAAAATTAGCTGGG - Intergenic
1121027364 14:90626442-90626464 ACATCTCCAGTGAAGGAGCTGGG + Intronic
1121054062 14:90838701-90838723 AAAAAGCCAGACAAGGGGCTGGG + Intergenic
1121118797 14:91362766-91362788 AAATATACAAAAAATAAGCTGGG + Intronic
1121134998 14:91489066-91489088 AAATATACAAAAAATAAGCTGGG - Intronic
1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG + Intronic
1121575984 14:94988252-94988274 AAATATACAAAAAATTAGCTGGG - Intergenic
1121698285 14:95930573-95930595 AGTTATCCAGAAATGGAACTGGG + Intergenic
1121897216 14:97659591-97659613 AAATATACAAAAAATTAGCTGGG + Intergenic
1122492993 14:102132661-102132683 AAATATCAATACAAGGGGCTGGG + Intronic
1122581177 14:102772657-102772679 AAAAATACAAAAAATGAGCTGGG - Intergenic
1202885028 14_KI270722v1_random:97607-97629 AAAAATACAGAAAATTAGCTGGG + Intergenic
1123423425 15:20149045-20149067 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1123503527 15:20914299-20914321 AAAAATACAGAAAATTAGCTGGG - Intergenic
1123532646 15:21155566-21155588 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1123560775 15:21487965-21487987 AAAAATACAGAAAATTAGCTGGG - Intergenic
1123597013 15:21925261-21925283 AAAAATACAGAAAATTAGCTGGG - Intergenic
1123739534 15:23223155-23223177 AAAAATACAAAAAATGAGCTGGG - Intergenic
1124287664 15:28418051-28418073 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124288185 15:28423752-28423774 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124290755 15:28452127-28452149 AAAAATACAAAAAATGAGCTGGG - Intergenic
1124292481 15:28465431-28465453 AAAAATACAAAAAATGAGCTGGG + Intergenic
1124435515 15:29645717-29645739 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124507060 15:30287197-30287219 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1124706544 15:31971320-31971342 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1124736497 15:32251464-32251486 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1124807804 15:32904165-32904187 ATGGATCCAGAAGAGGAGCTAGG + Intronic
1124865020 15:33481639-33481661 AAATATACAAAAAATTAGCTGGG - Intronic
1125012973 15:34900051-34900073 AAAAATTCAAAAAAGTAGCTGGG - Intronic
1125155660 15:36581716-36581738 AAAAATCCAAAAAATTAGCTGGG + Intronic
1125155796 15:36583853-36583875 AAAAATACAGAAAATTAGCTGGG + Intronic
1125625114 15:41102028-41102050 AAAAATACAAAAAAGTAGCTGGG + Intronic
1125893487 15:43282887-43282909 AAAAATACAAAAAAGTAGCTGGG + Intronic
1126127414 15:45308394-45308416 AAATATACAAAAAAGTAGCCAGG + Intergenic
1126130591 15:45337628-45337650 AAATATACAAAAAATTAGCTGGG + Intergenic
1126286642 15:47020046-47020068 AAAAATACAGAAAATTAGCTGGG + Intergenic
1126648529 15:50898703-50898725 AAAAATACAAAAAATGAGCTAGG - Intergenic
1127092727 15:55482516-55482538 AAAAATACAAAAAACGAGCTGGG + Intronic
1127231339 15:56999035-56999057 AAATATACAAAAAATTAGCTGGG + Intronic
1127236285 15:57056299-57056321 GAAAATACAGAAAAGTAGCTGGG - Intronic
1127432066 15:58920154-58920176 AAAAATACAAAAAAGTAGCTGGG + Intronic
1127937762 15:63659409-63659431 AAAAATGAAGAAAAGTAGCTGGG - Intronic
1128235444 15:66064206-66064228 AAAAACACAGAAAATGAGCTGGG + Intronic
1128837402 15:70821456-70821478 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1129415855 15:75379058-75379080 AAAAATACAGAAAATTAGCTGGG - Intronic
1129442039 15:75588661-75588683 AAATATAAAGAAAATCAGCTAGG + Intergenic
1129448406 15:75634880-75634902 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1129544611 15:76381982-76382004 ATATATCCAGAAAGGAAGCTAGG - Intronic
1129827389 15:78642612-78642634 ATATACCCAGGACAGGAGCTTGG + Intronic
1130196939 15:81788493-81788515 AAATATACAAAAAATTAGCTGGG + Intergenic
1130222670 15:82033736-82033758 AAAAATACAGAAAATTAGCTGGG - Intergenic
1130378476 15:83351747-83351769 AAATATACAAAAAACGGGCTTGG + Intergenic
1131088433 15:89598844-89598866 AAAAATACAGAAAATAAGCTAGG + Intronic
1131462368 15:92626889-92626911 AAAAATACAAAAAATGAGCTGGG + Intronic
1131479039 15:92766686-92766708 AAAAATACAAAAAATGAGCTGGG + Intronic
1131599925 15:93836888-93836910 AAATATACAAAAAATTAGCTGGG + Intergenic
1131910485 15:97194639-97194661 AAAAATACAGAAAATTAGCTGGG - Intergenic
1132067856 15:98747355-98747377 AAAAATACAGAAAATTAGCTGGG - Intronic
1132126641 15:99232316-99232338 AAAAATACAGAAAATTAGCTGGG + Intronic
1132271579 15:100530921-100530943 AAAAATACAAAAAATGAGCTGGG + Intronic
1202969120 15_KI270727v1_random:215128-215150 AAAAATACAGAAAATTAGCTGGG - Intergenic
1132511395 16:343540-343562 AAAAATACAGAAAATTAGCTGGG + Intronic
1132979692 16:2730547-2730569 AAATATACAAAAAATTAGCTGGG - Intergenic
1133019057 16:2958507-2958529 AAAAATACAGAAAAGTAGCCGGG + Intergenic
1133095023 16:3438400-3438422 AAAAATACAGAAAATTAGCTGGG + Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133129781 16:3669671-3669693 AAATATACAAAAAATTAGCTGGG + Intronic
1133176700 16:4020663-4020685 AAATATACAAAAAATTAGCTGGG + Intronic
1133204527 16:4225421-4225443 AAAAATACAAAAAATGAGCTGGG + Intronic
1133581135 16:7145634-7145656 AAACACCCAGAAAATGAGCATGG - Intronic
1133756404 16:8765502-8765524 AAATATACAAAAAATTAGCTGGG + Intronic
1133793514 16:9027930-9027952 AAATACCCAAAAAATTAGCTGGG - Intergenic
1133956824 16:10451890-10451912 AAAAATACAAAAAAGTAGCTGGG + Intronic
1134262989 16:12668335-12668357 AAATGTCAAGATAAGGAGTTTGG + Intronic
1134271140 16:12734538-12734560 AAAAATCCAGAAAATTAGCCGGG - Intronic
1134330348 16:13245074-13245096 AAAAATACAGAAAATTAGCTGGG - Intergenic
1134403095 16:13929802-13929824 AAAAATACAAAAAATGAGCTGGG + Intronic
1134557735 16:15180417-15180439 AAACATCAAGTAAAGGGGCTTGG + Intergenic
1134871896 16:17659550-17659572 GAATTTCCAGAAAAAGAGCCAGG + Intergenic
1135030492 16:19034435-19034457 AAAAATACAGAAAATTAGCTGGG + Intronic
1135107523 16:19663148-19663170 AAATATACAAAAAATTAGCTGGG + Intronic
1135258156 16:20958231-20958253 AAAAATACAAAAAATGAGCTGGG - Intronic
1135274314 16:21098276-21098298 AAAAATACAAAAAATGAGCTGGG + Intronic
1135541299 16:23332354-23332376 AAATATACAAAAAATTAGCTGGG - Intronic
1135560534 16:23472871-23472893 AAAAATACAAAAAAGTAGCTGGG + Intronic
1135618893 16:23936096-23936118 AGATATCCAGAGAAGGGGGTGGG - Intronic
1135632109 16:24044196-24044218 AAAAATCCAAAAAATTAGCTGGG + Intronic
1136254156 16:29027133-29027155 AAAAATACAGAAAATTAGCTGGG - Intergenic
1136344338 16:29665213-29665235 AAAAATACAAAAAAGCAGCTGGG - Exonic
1136603637 16:31315616-31315638 AAATATACAAAAAAGTAGCCAGG - Intronic
1136861396 16:33706561-33706583 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1137320125 16:47372071-47372093 AAAAATACAGAAAATTAGCTGGG - Intronic
1137448246 16:48545864-48545886 AAAAATACAAAAAAAGAGCTGGG + Intronic
1137640193 16:50022379-50022401 AAATATACAAAAAATTAGCTGGG - Intergenic
1137796304 16:51223158-51223180 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1138410984 16:56840179-56840201 AAATATACAAAAAATTAGCTGGG - Intronic
1138437185 16:57009430-57009452 AAAAATACAAAAAATGAGCTGGG + Intronic
1138493673 16:57393762-57393784 AAATATAAAGAAAATCAGCTGGG - Intergenic
1138508049 16:57488067-57488089 AAAAATCCAAAAAATTAGCTAGG - Intergenic
1138616164 16:58169085-58169107 AAAAATACAGAAAATTAGCTGGG - Intronic
1138617438 16:58181136-58181158 AAATAACCGTAAAAGGAGCAGGG + Intronic
1138669837 16:58604973-58604995 AAAAATACAAAAAAGTAGCTGGG + Intronic
1138748773 16:59394186-59394208 AAAAATACAAAAAATGAGCTGGG - Intergenic
1139010219 16:62622685-62622707 AAATAACCAGAAAAGAATCCTGG - Intergenic
1139488729 16:67274352-67274374 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1139687360 16:68614621-68614643 AAATATCAAAAAAATTAGCTGGG + Intergenic
1140038890 16:71392232-71392254 AAATATACAAAAAATTAGCTGGG + Intergenic
1140099737 16:71905537-71905559 AAAAATACAAAAAAGTAGCTGGG - Intronic
1140347716 16:74230356-74230378 AAATGTACTTAAAAGGAGCTGGG - Intergenic
1140438068 16:74964901-74964923 AAAAATACAAAAAATGAGCTGGG + Intronic
1140538133 16:75729948-75729970 AAAAATACAAAAAAGTAGCTGGG - Intronic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1140573402 16:76135437-76135459 AAATATCCTGCAAAGGAGACAGG - Intergenic
1141066767 16:80920323-80920345 AAAAATACAAAAAATGAGCTGGG + Intergenic
1141232336 16:82180749-82180771 AAAAATACAGAAAATTAGCTGGG + Intergenic
1141304987 16:82854238-82854260 AAAAATACAGAAAATTAGCTAGG + Intronic
1141456561 16:84145934-84145956 AAAAATACAAAAAATGAGCTGGG + Intronic
1141825699 16:86478277-86478299 AAATGTCCATCAATGGAGCTTGG + Intergenic
1141906497 16:87030109-87030131 AAAAATACAGAAAATTAGCTAGG + Intergenic
1142344114 16:89543106-89543128 AAAAATACAGAAAATTAGCTGGG - Intronic
1203053087 16_KI270728v1_random:894724-894746 AAAAATACAGAAAATTAGCTGGG - Intergenic
1203122895 16_KI270728v1_random:1554752-1554774 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1142484931 17:240895-240917 AAACATACAAAAAATGAGCTCGG + Intronic
1142576884 17:915093-915115 AAAAATACAAAAAATGAGCTTGG - Intronic
1142719831 17:1768632-1768654 AAATACCCAAAAAATTAGCTGGG - Intronic
1142724681 17:1804034-1804056 AAAAATACAAAAAATGAGCTGGG - Intronic
1142725885 17:1813573-1813595 AAATATACAAAAAATTAGCTGGG - Intronic
1142928071 17:3258686-3258708 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1143065370 17:4243225-4243247 AAAAATACAAAAAATGAGCTGGG - Intronic
1143088121 17:4432206-4432228 AAATACACAAAAAAGTAGCTGGG - Intergenic
1143177053 17:4961602-4961624 AAATATACAAAAAATTAGCTGGG + Intronic
1143194018 17:5061518-5061540 AAAAATACAAAAAAGTAGCTAGG + Intergenic
1143263007 17:5614262-5614284 AAATCCCGAGAGAAGGAGCTGGG + Intronic
1143675919 17:8432543-8432565 AAAAATCCAAAAAATTAGCTGGG - Intronic
1143709107 17:8721597-8721619 AAAAATACAGAAAATTAGCTGGG + Intergenic
1143753134 17:9045654-9045676 AATAAGCCAGAAAAGGAGATGGG + Intronic
1144118394 17:12124834-12124856 AAAAATACAAAAAAGTAGCTGGG - Intronic
1144357171 17:14457408-14457430 AAATATACAAAAAATTAGCTGGG - Intergenic
1144385142 17:14742430-14742452 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1144528972 17:16017598-16017620 AAAAATACAAAAAATGAGCTAGG + Intronic
1144620397 17:16815052-16815074 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1144636795 17:16915185-16915207 AAAAATACAAAAAAGCAGCTGGG + Intergenic
1144969660 17:19099767-19099789 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1144978256 17:19152297-19152319 AAAAATACAAAAAAGTAGCTGGG - Intronic
1144989965 17:19225936-19225958 AAAAATACAAAAAAGTAGCTGGG + Intronic
1145227235 17:21140182-21140204 AAATATACAAAAAATTAGCTGGG - Intronic
1145300385 17:21630608-21630630 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1145349903 17:22072630-22072652 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1145951755 17:28824036-28824058 AAAAATACAAAAAATGAGCTGGG - Intronic
1146031667 17:29371605-29371627 AAAAATACAGAAAATTAGCTGGG + Intergenic
1146097008 17:29940234-29940256 AAAAATACAAAAAAGTAGCTGGG - Intronic
1146111324 17:30092546-30092568 AAAAATACAGAAAATTAGCTGGG - Intronic
1146145992 17:30416939-30416961 AAAAATACAGAAAATTAGCTGGG + Intronic
1146202956 17:30875974-30875996 AAATATACAAAAAATTAGCTGGG + Intronic
1146379328 17:32317030-32317052 AAAAATACAAAAAAGTAGCTGGG - Intronic
1146617027 17:34364856-34364878 AAATATCCAGGTGAGTAGCTCGG - Intergenic
1146710112 17:35033709-35033731 AAATAAACAGGAAAGGGGCTGGG + Intronic
1147061074 17:37879021-37879043 AAAAATACAGAAAATTAGCTAGG + Intergenic
1147222756 17:38948508-38948530 AAAAATCCAGAATAGGGGCGGGG - Intronic
1147653551 17:42075653-42075675 AAAAATACAAAAAATGAGCTGGG - Intergenic
1147785575 17:42976141-42976163 AAAAATACAAAAAATGAGCTGGG - Intronic
1147871883 17:43593259-43593281 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1147908748 17:43841761-43841783 AAAATACCAGAAAATGAGCTGGG + Intergenic
1148202754 17:45760707-45760729 AAATATAAAGAAAATTAGCTGGG - Intergenic
1148500106 17:48083661-48083683 AAAAATCCAAAAAATTAGCTGGG + Intronic
1148528509 17:48366065-48366087 AAAGATGCAGAAAAGGTGATAGG + Intronic
1148763151 17:50019465-50019487 AAACATCCAAAAAATTAGCTGGG + Intergenic
1149221965 17:54425330-54425352 CATTACCCAGAAAAGGAGCATGG - Intergenic
1149466473 17:56884139-56884161 AAATATCCAGCATGGGACCTTGG + Intergenic
1149662317 17:58340829-58340851 AAATACCCCCAAAATGAGCTGGG + Intergenic
1149690462 17:58571395-58571417 AAAGATACAGAAAATTAGCTGGG - Intronic
1149697864 17:58630592-58630614 AAATTTCCTGAGAAGGAACTGGG + Intronic
1149707942 17:58712657-58712679 AAAAATACAAAAAAGTAGCTAGG + Intronic
1149710387 17:58736376-58736398 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1149764735 17:59265738-59265760 AAATACCAAAAAAAGTAGCTGGG + Intronic
1149804843 17:59606583-59606605 AAATATACAAAAAACTAGCTGGG + Intronic
1149821274 17:59780429-59780451 AAAAATACAGAAAATTAGCTGGG + Intronic
1149836183 17:59915147-59915169 AAAAATACAAAAAAGTAGCTGGG - Intronic
1150043036 17:61883846-61883868 AAATCTCTAGAAAATTAGCTGGG + Intronic
1150096329 17:62379256-62379278 AAAAATACAAAAAAGTAGCTGGG + Intronic
1150366442 17:64590300-64590322 AAAAATACAAAAAATGAGCTGGG - Intronic
1150484571 17:65534767-65534789 AACAATACAAAAAAGGAGCTGGG + Intronic
1150741498 17:67782259-67782281 AAAAATACAGAAAATTAGCTGGG + Intergenic
1150742894 17:67793863-67793885 AAATACACAGAAAATTAGCTGGG + Intergenic
1150977885 17:70109424-70109446 ACAGATCCAGATATGGAGCTGGG - Intronic
1151381482 17:73728639-73728661 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1151521944 17:74636496-74636518 CAATATCCAGACAAGGATATTGG - Intergenic
1151699059 17:75732925-75732947 AAAAATACAAAAAAGTAGCTGGG + Intronic
1151745756 17:76010899-76010921 AAAAATCCAAAAAATTAGCTGGG + Intronic
1151797892 17:76358667-76358689 AAAAATACAAAAAAGTAGCTGGG + Intronic
1152137228 17:78511788-78511810 ATATCTCCATGAAAGGAGCTGGG - Intronic
1152316666 17:79584924-79584946 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1152407110 17:80104101-80104123 AAAAATACAGAAAATTAGCTGGG + Intergenic
1152414268 17:80148714-80148736 AAAAATACAGAAAATTAGCTGGG - Intergenic
1152444720 17:80335080-80335102 AAAAATACAAAAAAGTAGCTGGG - Intronic
1152743018 17:82026737-82026759 AAAAATACAAAAAAGTAGCTGGG - Intronic
1153458930 18:5312524-5312546 AAAAATACAGAAAATTAGCTGGG + Intergenic
1153839747 18:8996063-8996085 AAATTACCAGAAATAGAGCTTGG + Intergenic
1153919540 18:9776083-9776105 ATAATTCCAGAAAAGGGGCTGGG - Intronic
1154033766 18:10778491-10778513 AAATATACAAAAAATTAGCTGGG - Intronic
1154225818 18:12502946-12502968 AAAAATACAAAAAAGTAGCTGGG + Intronic
1154263613 18:12860126-12860148 AAATATACAAAAAATCAGCTAGG + Intronic
1154368711 18:13737380-13737402 AAAAATACAGAAAATTAGCTGGG + Intronic
1154488251 18:14896290-14896312 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1154951711 18:21216779-21216801 AAATATGCAAAAAATTAGCTGGG + Intergenic
1154994533 18:21627106-21627128 AAAAATACAAAAAAGTAGCTGGG + Intronic
1155090683 18:22506669-22506691 AAAAATACAGAAAATTAGCTGGG - Intergenic
1155216220 18:23645412-23645434 AAAAATACAGAAAATTAGCTGGG + Intronic
1155220847 18:23684282-23684304 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1155366520 18:25054628-25054650 AAATGGACAGAAAAAGAGCTTGG + Intergenic
1155565651 18:27131388-27131410 AAAAATACAGAAAATTAGCTGGG + Intronic
1155843645 18:30678129-30678151 AAAAATACAGAAAATTAGCTGGG - Intergenic
1155912708 18:31523238-31523260 AAATATACAAAAAATTAGCTGGG + Intronic
1155952279 18:31926593-31926615 AAAAATACAGAAAATCAGCTGGG - Intronic
1156023862 18:32629889-32629911 AAAAATACAGAAAATTAGCTGGG + Intergenic
1156100734 18:33591800-33591822 AAAAATACAAAAAAGTAGCTGGG - Intronic
1156570442 18:38246262-38246284 TGATATCCAGAAAAAGAGCAAGG - Intergenic
1156620059 18:38840512-38840534 AAAAATACAAAAAATGAGCTGGG + Intergenic
1156681030 18:39588914-39588936 TAATATTCAGAAAAGGAGTGGGG - Intergenic
1156943971 18:42804392-42804414 AAAAATACAAAAAATGAGCTAGG + Intronic
1156946046 18:42832891-42832913 AAAAATACAAAAAAGTAGCTGGG + Intronic
1158547240 18:58406718-58406740 AAAAATGCAGAAAATTAGCTGGG - Intergenic
1158581257 18:58685466-58685488 ACAAATCCAGAAAAGAAACTTGG - Intronic
1159357240 18:67352010-67352032 AAATATCCACAAAATTAGATAGG - Intergenic
1159375046 18:67582296-67582318 GAATATCTAGAAATGGAGGTTGG + Intergenic
1159530969 18:69654895-69654917 AAAGATACAGAAAATTAGCTGGG + Intronic
1159784794 18:72700098-72700120 AAAAATCCAGAAAATAAGCGGGG + Intergenic
1159794692 18:72827553-72827575 AAAAATACAAAAAATGAGCTGGG + Intronic
1159916315 18:74191182-74191204 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1160814886 19:1030463-1030485 AAAAATACAAAAAATGAGCTGGG + Intronic
1160927019 19:1551452-1551474 AAATATACAAAAAATTAGCTAGG + Intergenic
1160984688 19:1833061-1833083 AAAAATACAAAAAATGAGCTGGG + Intronic
1161259283 19:3327691-3327713 AAATATACAAAAAATTAGCTGGG - Intergenic
1161463323 19:4412381-4412403 AAAAATACAGAAAATTAGCTGGG + Intronic
1161491523 19:4564675-4564697 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1161690197 19:5728051-5728073 AAAAATACAGAAAATTAGCTGGG + Intronic
1161830841 19:6603102-6603124 AAAAATACAAAAAAGTAGCTGGG - Intronic
1161925484 19:7295815-7295837 AAAAATACAGAAAATTAGCTGGG - Intergenic
1161945083 19:7430642-7430664 AAATATCTAAAAAATTAGCTGGG + Intronic
1162077767 19:8199888-8199910 AAAAATACAAAAAAGTAGCTGGG + Intronic
1162115554 19:8427206-8427228 AAAAATACAGAAAATTAGCTGGG - Intronic
1162126992 19:8505003-8505025 AAAAATCCAGAAAATTAGCCGGG - Intergenic
1162211738 19:9097300-9097322 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1162243895 19:9382864-9382886 AAAAATACAAAAAAGTAGCTAGG - Intergenic
1162511592 19:11122256-11122278 AAATATACAAAAAAGTAGCCGGG - Intronic
1162557256 19:11394930-11394952 AAATACCAAAAAAATGAGCTAGG + Intronic
1162578820 19:11515262-11515284 AAAAATCCAAAAAATTAGCTGGG - Intronic
1162700209 19:12509360-12509382 AAAAATACAGAAAATTAGCTGGG - Intronic
1162812962 19:13175627-13175649 AAATATACAAAAAATTAGCTGGG + Intergenic
1162945475 19:14040659-14040681 AAAAATACAAAAAAGTAGCTGGG + Intronic
1162999736 19:14359264-14359286 AAAAATACAAAAAATGAGCTGGG - Intergenic
1163000045 19:14361525-14361547 AAAAATACAAAAAATGAGCTGGG + Intergenic
1163146454 19:15382360-15382382 AAAAATACAAAAAAGTAGCTGGG - Intronic
1163208009 19:15818223-15818245 AAAAATACAGAAAACTAGCTGGG - Intergenic
1163313684 19:16528790-16528812 AAAAATACAAAAAAGTAGCTGGG + Intronic
1163771595 19:19194391-19194413 AAATACCCAAAAAATTAGCTGGG - Intronic
1163970984 19:20795030-20795052 AAAAATACAAAAAAGTAGCTGGG - Intronic
1164464973 19:28480010-28480032 AAAAATACAAAAAATGAGCTGGG + Intergenic
1164471958 19:28543734-28543756 AAAAATACAGAAAATTAGCTGGG - Intergenic
1164544907 19:29152290-29152312 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1164591552 19:29510418-29510440 AAAAATACAGAAAATTAGCTGGG - Intergenic
1164659641 19:29951705-29951727 AAAAATACAAAAAAGTAGCTGGG - Intronic
1164781715 19:30898067-30898089 AAAAATACAGAAAATTAGCTGGG - Intergenic
1164980919 19:32613867-32613889 AAATATACAAAAAATTAGCTGGG - Intronic
1165041956 19:33074890-33074912 AAATATACAAAAAATTAGCTGGG + Intergenic
1165653383 19:37510855-37510877 AAAAATACAAAAAAGTAGCTGGG - Intronic
1165779651 19:38425022-38425044 AAAAATACAAAAAAGTAGCTGGG + Intronic
1165816228 19:38644020-38644042 AAATATACAAAAAATTAGCTGGG + Intergenic
1165876675 19:39012660-39012682 ATATATCAAGAAAAGAAGCGGGG + Intronic
1166013492 19:39961465-39961487 AAAAATTCAGAAAATTAGCTGGG - Intergenic
1166086617 19:40480088-40480110 AAAAATACAGAAAATTAGCTGGG + Intronic
1166239241 19:41478568-41478590 AAAAATCCAGAAAAAGAGGCGGG + Intergenic
1166521065 19:43480429-43480451 AAAAATCCAAAAAATTAGCTGGG + Intronic
1166555436 19:43696737-43696759 AAATGTCCAGAACTGGAGCCTGG - Intergenic
1166701243 19:44882940-44882962 AAAAATCCAAAAAATTAGCTGGG - Intronic
1166793986 19:45415172-45415194 AAAAATACAAAAAAGTAGCTGGG + Intronic
1166802595 19:45467715-45467737 AATTAGCCATATAAGGAGCTCGG - Intronic
1166921971 19:46234747-46234769 AAAAATACAAAAAAGGAGCCGGG + Intergenic
1166987845 19:46672708-46672730 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1167085232 19:47305079-47305101 AAAAATACAAAAAAGTAGCTGGG - Intronic
1167088594 19:47327851-47327873 AAAAATACAGAAAATTAGCTGGG - Intergenic
1167522320 19:49962510-49962532 AAATATACAAAAAATTAGCTGGG - Intergenic
1167587980 19:50385686-50385708 AAAAATACAAAAAATGAGCTGGG - Intronic
1167614892 19:50527191-50527213 AAAAATGCAGAAAATTAGCTGGG - Intronic
1168039877 19:53749639-53749661 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1168159128 19:54497161-54497183 AAAAATACAGAAAATTAGCTGGG - Intergenic
1168321435 19:55512640-55512662 AAATATACAAAAAATTAGCTGGG - Intronic
1168393042 19:56026365-56026387 AAAAATACAGAAAATTAGCTGGG + Intronic
1168396377 19:56052427-56052449 AAAAATACAAAAAAGTAGCTGGG - Intronic
1168608851 19:57782836-57782858 AAATATACAAAAAATTAGCTGGG - Intronic
1168678728 19:58298188-58298210 AAAAATACAAAAAAGTAGCTGGG - Exonic
1168714873 19:58520889-58520911 AAAAATACAGAAAATTAGCTGGG + Intronic
1202634185 1_KI270706v1_random:28941-28963 AAAAATACAGAAAATTAGCTGGG + Intergenic
1202660435 1_KI270708v1_random:64633-64655 AAAAATACAGAAAATTAGCTGGG + Intergenic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925323181 2:2992873-2992895 AATTCTCCAGAAAATGACCTAGG - Intergenic
925794148 2:7524790-7524812 AAAAATACAGAAAATTAGCTAGG - Intergenic
925883658 2:8374954-8374976 AAACATCCGGAAAATTAGCTGGG - Intergenic
925990777 2:9252419-9252441 AAAAATACAGAAAATTAGCTGGG + Intronic
925998917 2:9314636-9314658 AAACATTTAGAAAAGGGGCTGGG + Intronic
926137878 2:10349540-10349562 AAATATACAAAAAATTAGCTGGG + Intronic
926525163 2:13971361-13971383 AAATATCCAAAAAAATAGCCAGG - Intergenic
926551606 2:14308477-14308499 AAAAATACAAAAAATGAGCTAGG + Intergenic
926891412 2:17642467-17642489 AAATATACAAAAAATTAGCTGGG - Intronic
927340682 2:21980464-21980486 AAATACCTACAAAAGGGGCTCGG + Intergenic
927490012 2:23515119-23515141 AAATATCCAGAAAGTGATTTGGG - Intronic
928144593 2:28761059-28761081 AAAAATACAGAAAATTAGCTGGG - Intronic
928306804 2:30177091-30177113 AAAAATACAAAAAATGAGCTGGG - Intergenic
928678000 2:33669029-33669051 AAAAATGCAGAAAATTAGCTGGG + Intergenic
928705063 2:33940786-33940808 AAAAATACAAAAAAGTAGCTGGG - Intergenic
928714349 2:34043238-34043260 AAATATACAAAAAATTAGCTGGG - Intergenic
928820521 2:35355940-35355962 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
928826092 2:35423031-35423053 ATATATCAATGAAAGGAGCTTGG + Intergenic
929025831 2:37600737-37600759 AAAGTTCCAGAAAATGAGCAGGG - Intergenic
929143453 2:38686424-38686446 AAAAATACAAAAAAGTAGCTGGG - Intronic
929378181 2:41316430-41316452 AAAAATACAAAAAATGAGCTGGG - Intergenic
929394501 2:41507397-41507419 AAAAATACAAAAAAGTAGCTGGG + Intergenic
929474448 2:42231786-42231808 AAATATACAGAAAATTAGCCAGG + Intronic
929479737 2:42293768-42293790 AAAAATACAAAAAAGTAGCTGGG - Intronic
930103659 2:47622111-47622133 AAAAATACAGAAAATTAGCTGGG - Intergenic
930110828 2:47677086-47677108 AAAAATCCAAAAAATTAGCTGGG + Intergenic
930179488 2:48338560-48338582 AAAAATACAGAAAATTAGCTGGG - Intronic
930278457 2:49341190-49341212 AAAAATACATAAAATGAGCTGGG - Intergenic
930414251 2:51069648-51069670 AAAAATGCAGCAAAGGAGTTCGG + Intergenic
930829172 2:55724962-55724984 AAATATACAAAAAATTAGCTGGG + Intergenic
931035611 2:58239869-58239891 AAATTTACAGAAAAGTAGCAAGG - Intronic
931233894 2:60397240-60397262 AAATATACAAAAAATTAGCTGGG - Intergenic
931457089 2:62418900-62418922 AAATATACAAAAAATTAGCTGGG + Intergenic
932151298 2:69374472-69374494 AAATATACAAAAAATTAGCTGGG - Intronic
932181692 2:69652163-69652185 AAAAATACAGAAAATTAGCTGGG - Intronic
932233317 2:70100831-70100853 AAAAATACAGAAGAGTAGCTGGG + Intergenic
932420558 2:71598956-71598978 ACATATCCGGAAAAGGCGCTTGG + Intronic
932547492 2:72729582-72729604 AAAAAACAAAAAAAGGAGCTGGG - Intronic
932645404 2:73495393-73495415 AAAAATACAGAAAATTAGCTGGG - Intronic
932652716 2:73576779-73576801 AAAAATCCAAAAAAATAGCTGGG - Intronic
933241171 2:79921959-79921981 AAATCTCCAGGGAAAGAGCTGGG + Intronic
933346866 2:81097990-81098012 AAAAATCCAAAAAATTAGCTGGG - Intergenic
933569303 2:83990765-83990787 AGATAATCACAAAAGGAGCTTGG - Intergenic
933633911 2:84686025-84686047 AAAAATCCAAAAAAATAGCTGGG + Intronic
933642223 2:84776208-84776230 AAATGTCCAGTGAAGGAGCCAGG + Intronic
933676167 2:85059762-85059784 AAAAATACAAAAAAGTAGCTGGG - Intergenic
933699707 2:85245652-85245674 AAAAATACAAAAAATGAGCTGGG + Intronic
933953115 2:87348041-87348063 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934237346 2:90244386-90244408 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934303735 2:91802335-91802357 AAAAATACAAAAAAGGAGCCGGG + Intergenic
934329519 2:92050417-92050439 AAAAATACAAAAAAGGAGCCGGG - Intergenic
934459771 2:94207680-94207702 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
934496796 2:94809660-94809682 AAAAATACAGAAAATTAGCTGGG - Intergenic
934544515 2:95203660-95203682 AAAAATACAAAAAAGTAGCTGGG + Intergenic
934688548 2:96339429-96339451 AAAAATACAAAAAAGTAGCTGGG + Intronic
934781792 2:96974085-96974107 AAATATACAGAAAAGGGGCTGGG + Intronic
934785420 2:97001803-97001825 AAAAATACAAAAAATGAGCTGGG - Intronic
934846791 2:97666374-97666396 AAAAATACAAAAAAGTAGCTGGG + Intergenic
935228289 2:101073453-101073475 AAAAATACAAAAAAGTAGCTGGG - Intronic
935239317 2:101164621-101164643 AAAAATACAGAAAATTAGCTGGG - Intronic
935695927 2:105771081-105771103 AAAAATACAAAAAAGTAGCTGGG - Intronic
935700894 2:105811012-105811034 AAAAATACAAAAAAGTAGCTGGG + Intronic
936009140 2:108913963-108913985 AAAAATCTAGAAAAGGGGCCGGG + Intronic
936108707 2:109647627-109647649 AAATATACAAAAAATTAGCTGGG - Intergenic
936300471 2:111301170-111301192 AAATATACAAAAAATTAGCTGGG - Intergenic
936341293 2:111634747-111634769 AATTATCCAGAAAAAGAATTAGG + Intergenic
936450396 2:112629620-112629642 AAAAATTCAAAAAATGAGCTGGG + Intergenic
936482771 2:112900478-112900500 AAATTTCCAGGGAAGGAGTTTGG + Intergenic
936703824 2:115045703-115045725 TAATATCAAGAAAAGAAGCATGG - Intronic
936771324 2:115917001-115917023 AAAAATCCAAAAAATTAGCTGGG + Intergenic
937406920 2:121638826-121638848 AAATATACAAAAAATTAGCTGGG - Intronic
937657437 2:124392592-124392614 AATTATTCAGAGCAGGAGCTAGG - Intronic
937946494 2:127343228-127343250 AAAGAAACAGAAAAGGAGCCAGG + Intronic
938075189 2:128328511-128328533 AACCATCCTGGAAAGGAGCTTGG - Intergenic
938111047 2:128565284-128565306 AACTATGCAGAAAAGAAGGTGGG - Intergenic
938724317 2:134093353-134093375 AAAAATACAAAAAAGTAGCTGGG + Intergenic
939798822 2:146681426-146681448 AAATATACTGAAAAGGATTTTGG + Intergenic
940130373 2:150374671-150374693 AAATCACCAGAGAAGCAGCTGGG + Intergenic
940294226 2:152105628-152105650 AAAAATACAGAAAATGAGCCCGG + Intergenic
940868147 2:158837457-158837479 AAATATCTAGAACAGGAACCTGG + Intronic
940984758 2:160041708-160041730 AAGTATCCAGCCAAGAAGCTGGG + Intronic
941130838 2:161649206-161649228 AAAAATACAGAAAATTAGCTGGG + Intronic
941275857 2:163489893-163489915 AAAAATACAAAAAAGTAGCTGGG + Intergenic
941802913 2:169680684-169680706 AAGGATCCAGAAGAGGAGCAGGG + Intronic
941867517 2:170350156-170350178 AAACATACAGAAAATTAGCTGGG - Intronic
941869677 2:170371055-170371077 AAAAATACAGAAAATTAGCTGGG + Intronic
942078595 2:172379882-172379904 AAAAATACAGAAAATTAGCTGGG + Intergenic
942091928 2:172500467-172500489 AAATATACAAAAAATTAGCTGGG + Intronic
942174840 2:173323377-173323399 AAAAATACAAAAAAGTAGCTGGG - Intergenic
942316671 2:174702724-174702746 AAATAAACAAAAAAGGAGCCTGG - Intergenic
942482574 2:176404891-176404913 AAATAACCAGAAATAGAGGTAGG - Intergenic
942595371 2:177587159-177587181 AAAAATACAAAAAATGAGCTGGG + Intergenic
942652293 2:178181423-178181445 AAAAATACAAAAAAGGAGCCAGG + Intergenic
942778905 2:179617442-179617464 AAGCATTGAGAAAAGGAGCTTGG + Intronic
942825706 2:180172778-180172800 AAAAATACAGAAAATTAGCTGGG + Intergenic
942987061 2:182155728-182155750 AAAAATACAGAAAATTAGCTGGG + Intronic
943586704 2:189749083-189749105 AAAAATACAAAAAATGAGCTGGG + Intronic
943586955 2:189751981-189752003 AAAAATACAAAAAATGAGCTGGG + Intronic
944569038 2:201024326-201024348 AAAAATCAAGAAAATTAGCTGGG + Intronic
944631052 2:201625061-201625083 AAATATCCATAAAAGATGTTTGG + Intronic
944708632 2:202315903-202315925 AAAAATGCAGAAAATTAGCTGGG + Intergenic
944750852 2:202707926-202707948 AAAAATACAAAAAATGAGCTGGG - Intronic
944802939 2:203254105-203254127 AAAAATACAAAAAATGAGCTGGG - Intronic
944842076 2:203634303-203634325 AAATATACAAAAAATTAGCTGGG + Intergenic
944996353 2:205298887-205298909 AAGCATCCAGACCAGGAGCTGGG - Intronic
945090801 2:206173957-206173979 AAAAATCCAAAAAATTAGCTGGG - Intergenic
945231199 2:207592244-207592266 AAAAATACAAAAAATGAGCTGGG + Intronic
945485453 2:210390178-210390200 AAATGAGGAGAAAAGGAGCTGGG + Intergenic
945534120 2:210990365-210990387 AAAAATACAGAAAATTAGCTGGG + Intergenic
945663733 2:212717089-212717111 AAAAATACAGAAAATTAGCTGGG + Intergenic
945897580 2:215501909-215501931 AAACATTCAGAAAAGCAGATAGG + Intergenic
946062722 2:216958342-216958364 AAAAATACAGAAAATTAGCTGGG + Intergenic
946264596 2:218528039-218528061 AAAAATACAAAAAAAGAGCTGGG + Intronic
946314796 2:218903773-218903795 AAAAATACAAAAAATGAGCTGGG - Intergenic
946457113 2:219836275-219836297 AAAAATAAAGAAAAGTAGCTGGG - Intergenic
946522026 2:220476361-220476383 AAATTTACAGAGAAGGAACTTGG - Intergenic
946933004 2:224690136-224690158 AAATATCCTGAAAGGAAACTGGG - Intergenic
947236911 2:227950457-227950479 AAAAATACAGAAAATTAGCTGGG + Intergenic
947296807 2:228640423-228640445 AAATGTCCAGAAAAGATGCTAGG + Intergenic
947560990 2:231151971-231151993 AAAAATACAAAAAATGAGCTGGG - Intronic
947619270 2:231578194-231578216 AAAAATACAAAAAAGTAGCTGGG - Intergenic
947625738 2:231617194-231617216 AAAAATCCAAAAAATTAGCTGGG - Intergenic
947630227 2:231647883-231647905 AAAAATACAAAAAAGTAGCTGGG - Intergenic
947703825 2:232258421-232258443 AAAAATACAGAAAATGAGCCGGG + Intronic
947960503 2:234232609-234232631 AAAGATACAAAAAAGTAGCTGGG - Intergenic
948956673 2:241298203-241298225 AAAAATACAGAAAATTAGCTGGG + Intronic
1169049528 20:2564309-2564331 AAAAATACAGAAAATTAGCTGGG - Intronic
1169179085 20:3546550-3546572 AAATATGCAAAAAATTAGCTGGG - Intronic
1169359350 20:4935024-4935046 AAATATACAAAAAATTAGCTGGG + Intronic
1169665508 20:8030921-8030943 AAATGTCTACAAAATGAGCTGGG - Intergenic
1169805999 20:9559600-9559622 AAATATACAAAAAATTAGCTGGG + Intronic
1170292990 20:14791501-14791523 ATATATCCAGAAAAGGCCATGGG - Intronic
1170463449 20:16600694-16600716 TAATATTCAGTAAATGAGCTGGG - Intergenic
1171267395 20:23782851-23782873 AAATATCCAGCAAGGGCCCTGGG - Intergenic
1171559302 20:26108461-26108483 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1172058440 20:32171478-32171500 CAAAATCCATGAAAGGAGCTGGG - Intergenic
1172249506 20:33468953-33468975 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1172417201 20:34779351-34779373 AAATAAACAGAAAATTAGCTGGG + Intronic
1172429571 20:34878092-34878114 AAAAATACAAAAAAGTAGCTGGG - Intronic
1172575746 20:36007026-36007048 AAAAATACAGAAAATTAGCTGGG + Intronic
1172751625 20:37255498-37255520 AAATATACAAAAAATTAGCTGGG + Intronic
1173579921 20:44140030-44140052 AAAAATACAGAAAATTAGCTGGG - Intronic
1173607870 20:44344620-44344642 AAAAATCCAAAAAATTAGCTAGG + Intronic
1174096179 20:48091376-48091398 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1174360700 20:50027465-50027487 AAATACCCAGCAAAGGAGACAGG - Intergenic
1174448653 20:50607080-50607102 CAAAATGCAGAAAAGGAGCAGGG - Intronic
1174454938 20:50642187-50642209 AAATTCCCAGAAGAGGAGATTGG - Intronic
1174765749 20:53252513-53252535 AAATATCCATCAATGGAGATGGG - Intronic
1174775586 20:53340340-53340362 AAATATACAAAAAATTAGCTGGG - Intronic
1174894630 20:54435652-54435674 AAAAATACAAAAAATGAGCTGGG + Intergenic
1175033452 20:55977346-55977368 AAAGACCAAGAAAAGGAGTTGGG - Intergenic
1175087775 20:56474718-56474740 AAATCTGCAGAAAAGGCTCTTGG + Exonic
1175368061 20:58468853-58468875 AAATATCAAGAAAATGGGCTGGG - Intronic
1175837341 20:62004620-62004642 GAAAATTCAGAAAGGGAGCTGGG - Intronic
1176161230 20:63649985-63650007 AAAAATACAGAAAATTAGCTGGG - Intronic
1176646404 21:9354721-9354743 AAAAATACAGAAAATTAGCTGGG + Intergenic
1176859803 21:14003794-14003816 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1176877918 21:14152259-14152281 AAAAATTCAGAAAATTAGCTGGG - Intronic
1176888297 21:14282778-14282800 AAATATATAAAAAATGAGCTGGG + Intergenic
1176893125 21:14343355-14343377 AAATATACAAAAAATTAGCTGGG + Intergenic
1177065568 21:16429830-16429852 AAATATACAAAAAATTAGCTGGG - Intergenic
1177141431 21:17361942-17361964 AAATATACAAAAAATTAGCTGGG + Intergenic
1177397393 21:20555110-20555132 AAATATCAAAAAAAGGAGTCAGG + Intergenic
1177512731 21:22111112-22111134 AAATATACAAAAAATTAGCTTGG - Intergenic
1177586748 21:23106083-23106105 AAAAATGCAGAAAATTAGCTGGG + Intergenic
1178371578 21:32031417-32031439 AACTCAACAGAAAAGGAGCTGGG + Intronic
1178529872 21:33366963-33366985 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1178868494 21:36351226-36351248 AAAAATACAGAAAATTAGCTGGG - Intronic
1178985814 21:37301983-37302005 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1179165543 21:38932735-38932757 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1179577060 21:42314492-42314514 AAAAATCCAAAAAATTAGCTGGG + Intronic
1180100544 21:45581945-45581967 AAAAATACAGAAAATTAGCTGGG - Intergenic
1180327917 22:11448224-11448246 AAAAATACAGAAAATTAGCTGGG + Intergenic
1180366514 22:11944288-11944310 AAAAATACAGAAAATTAGCTGGG - Intergenic
1180616641 22:17132637-17132659 AAAAATACAGAAAATTAGCTGGG + Intergenic
1180660420 22:17462241-17462263 AAAAATACAGAAAATTAGCTGGG + Intronic
1180729240 22:17969198-17969220 AAAAATACAGAAAATTAGCTGGG - Intronic
1180878259 22:19185485-19185507 AAAAATACAAAAAAGTAGCTGGG - Intronic
1181144660 22:20836127-20836149 AAATGTCCTGAAAAAGAGCCAGG - Intronic
1181257370 22:21572272-21572294 AAAAATCCAAAAAATTAGCTGGG + Intronic
1181356428 22:22298776-22298798 AACTAGGCAGAAAAGGAGCAAGG - Intergenic
1181621960 22:24097313-24097335 AAATATACAGAAAATGATTTAGG - Intronic
1182186591 22:28409815-28409837 AAAAATCCAAAAAATTAGCTGGG - Intronic
1182272286 22:29162555-29162577 AAAAATACAGAAAATTAGCTGGG + Intronic
1182376282 22:29850712-29850734 AAAAATACAGAAAATTAGCTGGG + Intergenic
1182400842 22:30076422-30076444 AAATATAGAGAAAAAGAGATTGG - Intergenic
1182482199 22:30616320-30616342 AAAAATACAAAAAAGTAGCTGGG + Intronic
1182637915 22:31743639-31743661 AAAAATCCAAAAAATTAGCTGGG + Intronic
1182809313 22:33102648-33102670 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1182929597 22:34160006-34160028 AAAAATACAGAAAATTAGCTGGG - Intergenic
1182988532 22:34743983-34744005 AAAAATACAGAAAATTAGCTGGG - Intergenic
1182997972 22:34831843-34831865 AAATATACAAAAAATTAGCTGGG + Intergenic
1183121080 22:35730758-35730780 AAAAATACAAAAAATGAGCTGGG + Intergenic
1183672487 22:39281144-39281166 AAAAATACAGAAAATTAGCTGGG + Intergenic
1183802988 22:40183853-40183875 AAATATACAAAAAATTAGCTGGG - Intronic
1183992406 22:41606611-41606633 AAATATACAAAAAATTAGCTGGG + Intronic
1184072426 22:42154345-42154367 AAACATACAAAAAATGAGCTGGG - Intergenic
1184115036 22:42417374-42417396 GAATAACCAGAAAAGCAGCTGGG - Intronic
1184131954 22:42521946-42521968 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1184511651 22:44937023-44937045 AAAAATACAAAAAAGTAGCTGGG - Intronic
1184633304 22:45803616-45803638 AGAAATCCAGAAAAGAAGCAAGG - Intronic
1184736689 22:46402374-46402396 AAAAATACAGAAAATTAGCTGGG - Intronic
1184788452 22:46683872-46683894 AAATATACAAAAAATTAGCTGGG + Intergenic
1185405628 22:50647336-50647358 AAAAATACAGAAAATTAGCTTGG + Intergenic
1185421394 22:50736448-50736470 AAATAACCAGAAAAAGACTTTGG - Intergenic
949153621 3:800876-800898 AATTATCCTTAAAAAGAGCTTGG + Intergenic
949196388 3:1314209-1314231 AAATATTCATACAAAGAGCTTGG - Intronic
949461486 3:4299647-4299669 AAAAATACAAAAAAGTAGCTGGG + Intronic
949550307 3:5107088-5107110 AAAAAGTCAAAAAAGGAGCTGGG + Intergenic
949607811 3:5673723-5673745 AAATACCTATAAAAGGAGGTTGG + Intergenic
949630853 3:5924500-5924522 AAAAATACAAAAAATGAGCTGGG + Intergenic
949984774 3:9532184-9532206 AAATATTTAGAAAATTAGCTGGG - Intronic
949992250 3:9589195-9589217 AAATATACAAAAAATTAGCTGGG - Intergenic
950191372 3:10978725-10978747 AAATATACAAAAAACTAGCTGGG + Intergenic
950321461 3:12058679-12058701 AAAAACCCAGAAAGGGAGCATGG + Intronic
950697392 3:14713804-14713826 GAAGATACAGAAAAGCAGCTAGG + Intronic
950980320 3:17297413-17297435 AAAAATACAAAAAAAGAGCTGGG + Intronic
951214863 3:20014354-20014376 ATATATCCTGAAAAGGAGGATGG - Intergenic
951314950 3:21178889-21178911 AAGTATGCAGAAAAGGGGGTAGG - Intergenic
951522358 3:23621561-23621583 CACAATCCAGAACAGGAGCTAGG + Intergenic
951788640 3:26453630-26453652 AAAGATCCAAAAAATTAGCTGGG - Intergenic
952270249 3:31824010-31824032 AAAAATGCAAAAAAGTAGCTGGG - Intronic
952431818 3:33231108-33231130 AAAAATACAAAAAATGAGCTGGG - Intergenic
952452433 3:33444897-33444919 AAATATACAAAAAATTAGCTGGG - Intergenic
952651149 3:35728377-35728399 AAAAATACAGAAAATTAGCTGGG - Intronic
952795124 3:37232569-37232591 AAATATACAAAAAATGAGCCGGG - Intergenic
952891426 3:38044400-38044422 AAATATACAAAAAATTAGCTGGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953454366 3:43030164-43030186 AAAAATACAAAAAAGTAGCTGGG - Intronic
953494835 3:43377244-43377266 AAATATGCAAAAAATTAGCTGGG - Intronic
953948462 3:47168610-47168632 AAATATCCAAAAAATTAGCCGGG - Intergenic
953991538 3:47487762-47487784 AAAAATACAGAAAATTAGCTGGG - Intergenic
954030006 3:47812395-47812417 AAAAATACAGAAAATTAGCTAGG + Intronic
954115092 3:48462540-48462562 AAAAATACAAAAAAGTAGCTGGG + Intronic
954723693 3:52588713-52588735 AAAGATACAAAAAATGAGCTGGG - Intronic
955128393 3:56138218-56138240 AAAAATACAGAAAATTAGCTGGG - Intronic
955130989 3:56168340-56168362 TAATAGCCACAAAAGGAGCAGGG + Intronic
955227558 3:57073652-57073674 AATTCTCCAGAAAAGGAGGCTGG - Exonic
955592621 3:60553924-60553946 AAAAATACAGAAAATTAGCTGGG + Intronic
955598734 3:60621307-60621329 AAAAATACAAAAAAGTAGCTAGG - Intronic
955653339 3:61218045-61218067 AAATATCCAGGTAAGCAGTTGGG + Intronic
956293834 3:67690924-67690946 AAAAAGCAGGAAAAGGAGCTAGG + Intergenic
956378447 3:68640773-68640795 AAATATACAAAAAATTAGCTGGG - Intergenic
956668600 3:71664712-71664734 AAAAATACAAAAAAGTAGCTGGG + Intergenic
956713593 3:72059212-72059234 AAATATACAAAAAATTAGCTGGG + Intergenic
956731289 3:72198906-72198928 AAATATCCAGGGAAGGTGCCAGG - Intergenic
956775587 3:72562843-72562865 AAATCTCCAGAAATGGAGTGTGG + Intergenic
957037778 3:75311099-75311121 AAAAATACAGAAAATTAGCTGGG - Intergenic
957225669 3:77442149-77442171 AAAAATACAGAAAATTAGCTGGG + Intronic
957511758 3:81198271-81198293 AAATATCCACAAAGGGAGCTTGG + Intergenic
957542776 3:81596180-81596202 AAATATCAGGAAATGGATCTAGG + Intronic
957548284 3:81668821-81668843 AACTATCAAGCTAAGGAGCTAGG - Intronic
958140370 3:89554955-89554977 AAAAATACAAAAAAGTAGCTGGG - Intergenic
958760795 3:98305641-98305663 AAAAATGCAAAAAAGTAGCTGGG - Intergenic
958797036 3:98717018-98717040 AAAAATACAAAAAAGTAGCTGGG - Intergenic
958804920 3:98798893-98798915 AAAAATCCAGAAAAGAATATAGG + Exonic
959106764 3:102073509-102073531 AAAGATACAAAAAATGAGCTGGG + Intergenic
959136635 3:102430992-102431014 AAATATCTTGAAAAGGAACCTGG + Intronic
959652538 3:108765067-108765089 AAAAATACAAAAAAGTAGCTGGG + Intergenic
959801502 3:110500732-110500754 AAATATACAAAAAATTAGCTGGG - Intergenic
960194562 3:114749390-114749412 AAAAATACAAAAAAGTAGCTGGG + Intronic
960215955 3:115037442-115037464 AAAAATCCAAAAATTGAGCTGGG - Intronic
960272262 3:115688175-115688197 AAAAATCCAAAAAATTAGCTGGG - Intronic
960683030 3:120268694-120268716 AAAAATACAGAAAATTAGCTGGG - Intronic
960707812 3:120497388-120497410 AAATAGCCAGAAAAGGGGGAAGG - Intergenic
960795498 3:121482357-121482379 AAATATACAAAAAATTAGCTGGG + Intronic
960801407 3:121544190-121544212 AAAAATACAAAAAAGTAGCTGGG + Intronic
961036113 3:123642899-123642921 AAATCTCCAGAGGAGGAGCTTGG - Intronic
961836615 3:129666577-129666599 AAAAATACAAAAAAGTAGCTGGG + Intronic
961860877 3:129916207-129916229 AAAAATACAAAAAATGAGCTGGG + Intergenic
961955186 3:130794219-130794241 AAAAATACAAAAAAGGAGCCGGG + Intergenic
962545370 3:136428973-136428995 AAAAATACAGAAAACTAGCTAGG + Intronic
962788152 3:138786503-138786525 AAAAATCCAAAAAATTAGCTGGG - Intronic
962800461 3:138886062-138886084 AAAAATACAAAAAACGAGCTGGG + Intergenic
962849111 3:139294736-139294758 AAATATCAAAAAAATTAGCTGGG - Intronic
962999552 3:140665738-140665760 AAAAATACAGAAAATTAGCTGGG + Intergenic
963103176 3:141624396-141624418 AAAAATACAAAAAAGTAGCTGGG + Intergenic
963535745 3:146526020-146526042 AAAAATACAAAAAATGAGCTGGG + Intronic
963627662 3:147693287-147693309 AAATATACAAAAAATTAGCTGGG + Intergenic
963675884 3:148310799-148310821 AAATATTCAGAAAAAGACTTTGG - Intergenic
963713129 3:148770563-148770585 AAATAGGCAGAAAAGCAGCAAGG + Intergenic
964117364 3:153150093-153150115 AAATATATAAAAAATGAGCTGGG - Intergenic
964144900 3:153447928-153447950 AAATATACAAAAAATTAGCTGGG + Intergenic
964326618 3:155553471-155553493 AAATATCCAGAAAGTGATCTAGG + Intronic
964709386 3:159655726-159655748 AAATATACAAAAAATTAGCTAGG + Intronic
964729057 3:159845539-159845561 AAAAATACAGAAAATTAGCTGGG - Intronic
964789272 3:160436635-160436657 AAAAATACAGAAAATTAGCTGGG + Exonic
964796831 3:160507337-160507359 AAATATACAAAAAATTAGCTGGG + Intronic
964885658 3:161479398-161479420 AAAAATACAGAAAATTAGCTGGG - Intergenic
965026730 3:163311559-163311581 AAAAATACAGAAAATTAGCTGGG + Intergenic
965646812 3:170892266-170892288 AAATACACAAAAAAGTAGCTGGG + Exonic
965746398 3:171930295-171930317 AATTATCCTGGGAAGGAGCTTGG + Intronic
965902373 3:173657981-173658003 CAATATCCAGTAAAGGGACTTGG + Intronic
966134607 3:176684099-176684121 AAATATACAAAAAATTAGCTGGG - Intergenic
966273958 3:178142173-178142195 AAATGTCTAGAAATGGGGCTTGG - Intergenic
966719778 3:183050541-183050563 AAAAATGCAAAAAAGTAGCTGGG + Intronic
966725253 3:183102945-183102967 AAAAATACAAAAAATGAGCTAGG - Intronic
966806562 3:183812072-183812094 AAAAATACAGAAAATTAGCTGGG + Exonic
967047142 3:185748014-185748036 AAAAATACAAAAAAGTAGCTGGG - Intronic
967238313 3:187410881-187410903 AAAGAGCCAGAAATGGAGCCAGG + Intergenic
967723372 3:192838587-192838609 AAAAATACAAAAAAGTAGCTGGG - Intronic
967784364 3:193474156-193474178 AAAAATACAAAAAATGAGCTGGG + Intronic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968338737 3:197936521-197936543 AAAAATCAAGAAAAGTAGCTGGG - Intronic
968403728 4:320804-320826 AAATATACAAAAAATTAGCTGGG + Intergenic
968538956 4:1152663-1152685 AAATAGCCAGGAAGAGAGCTGGG - Intergenic
970198997 4:13582836-13582858 AACTATCCTTAAAAAGAGCTAGG - Intronic
970445350 4:16119370-16119392 AACTATCAAGAAAAGGTTCTGGG + Intergenic
970579892 4:17465537-17465559 AAAAATCAAGAAAATTAGCTGGG + Intronic
970597485 4:17613610-17613632 AAATATACAAAAAATTAGCTGGG + Intergenic
970630732 4:17941213-17941235 AAAAATACAAAAAATGAGCTGGG + Intronic
971018665 4:22513312-22513334 AAAAATACAGAAAATTAGCTGGG - Intronic
971082692 4:23232941-23232963 AATTTTCCAGAAAAATAGCTGGG + Intergenic
971121980 4:23714700-23714722 AAAAATACAAAAAAGTAGCTGGG - Intergenic
971401067 4:26275789-26275811 AAAAATACAAAAAAGTAGCTGGG - Intronic
971707074 4:30058627-30058649 AAATATACAAAAAATTAGCTGGG + Intergenic
971722693 4:30266903-30266925 ATATCTCCAAAAGAGGAGCTGGG + Intergenic
971745932 4:30580966-30580988 AAATAGCCAAAAAAGGAGATTGG - Intergenic
971783747 4:31073959-31073981 AAATAGCTAGAAAAGCAGTTTGG - Intronic
971905322 4:32717153-32717175 AAAAATGCAAAAAAGTAGCTGGG - Intergenic
972254506 4:37338788-37338810 ACATGTCCAGAGAAGGAGATTGG - Intronic
972433470 4:39007613-39007635 AAATACCAAAAAAATGAGCTGGG - Intronic
972449776 4:39184624-39184646 AAATTACCAAAAAATGAGCTGGG - Intronic
972449973 4:39187257-39187279 AAAAATACAAAAAAGTAGCTGGG + Intronic
972517922 4:39826644-39826666 AAAAATACAAAAAATGAGCTGGG - Intronic
972548350 4:40104111-40104133 AAAAATACAAAAAAGTAGCTGGG - Intronic
972641633 4:40930906-40930928 AAAAATACAGAAAATTAGCTGGG - Intronic
972755171 4:42039245-42039267 AAATATACAGAGAATGAGCATGG - Intronic
972854153 4:43086044-43086066 AAATATACATAAAACAAGCTTGG - Intergenic
972965444 4:44503442-44503464 AAATATACAAAAAATTAGCTGGG + Intergenic
973208464 4:47587482-47587504 AAAGATAGAGAAAAGGATCTAGG - Intronic
973397196 4:49605413-49605435 AAATATACAGAAAATTAGCCAGG - Intergenic
973700929 4:53536413-53536435 AAATATCTAGAAATGTATCTAGG + Intronic
973800139 4:54469628-54469650 AAATATACAGAAAATTAGCTGGG - Intergenic
974104242 4:57450300-57450322 AAAAATACAGAAAATTAGCTGGG - Intergenic
974879402 4:67735473-67735495 CATTATCAAGAAAAGGTGCTAGG - Intergenic
974910804 4:68117304-68117326 AAAAATACAGAAAATTAGCTGGG + Intronic
974931352 4:68364783-68364805 ACAAATACAGAAAAGTAGCTGGG - Intergenic
975809095 4:78147055-78147077 AAACATCCAGGAAAGGGGCAGGG - Intronic
976089889 4:81446213-81446235 AAATATACAAAAAATTAGCTGGG + Intronic
976140538 4:81986907-81986929 AAATATACAAAAAATTAGCTGGG - Intronic
976216413 4:82719662-82719684 AAATATACAAAAAATTAGCTGGG - Intronic
976457658 4:85267167-85267189 AAAAATACAGAAAATTAGCTGGG + Intergenic
976507900 4:85870801-85870823 AAATATCAAGAAGGGGAGGTTGG + Intronic
976565422 4:86546893-86546915 AAATATACAAAAAATTAGCTGGG + Intronic
976718917 4:88151575-88151597 AAAAATACAAAAAAGTAGCTGGG + Intronic
976754097 4:88479904-88479926 AAAAATACAGAAAATTAGCTGGG + Intronic
977144512 4:93420912-93420934 AAAAATACAAAAAAGTAGCTGGG - Intronic
977230780 4:94449926-94449948 AAAAATCCAAAAAATTAGCTGGG - Intergenic
977395237 4:96463058-96463080 AAAAATACAGAAAATTAGCTGGG - Intergenic
977398643 4:96503139-96503161 AAATATACAAAAAATTAGCTGGG - Intergenic
977609463 4:99017310-99017332 AAATATCCAGAAAATGAGATAGG - Intronic
977943194 4:102880101-102880123 AAAAATACAGAAAATTAGCTGGG - Intronic
978041888 4:104075994-104076016 AAATAGACAGAAAAGTAGCAGGG + Intergenic
978129490 4:105177925-105177947 AAAGATACAAAAAAGTAGCTGGG + Intronic
978184937 4:105846237-105846259 AAAAATCCAAAAAATGAGGTGGG + Exonic
978433968 4:108663370-108663392 AAAAATACAAAAAATGAGCTGGG - Intronic
978515756 4:109566950-109566972 AAAAATACAGAAAATTAGCTGGG + Intronic
978532814 4:109731183-109731205 AAAAATACAGAAAATTAGCTGGG + Intergenic
978796441 4:112712566-112712588 AAATATACAAAAAATTAGCTGGG - Intergenic
978799379 4:112740541-112740563 AAAAATACAAAAAAGTAGCTGGG + Intergenic
979691681 4:123565667-123565689 AATAATCCAGGAAAGGGGCTGGG - Intergenic
979797024 4:124858539-124858561 AGATATTCAGAAAATAAGCTAGG + Intergenic
979869297 4:125797552-125797574 AAAAATACAGAAAATTAGCTGGG - Intergenic
979886254 4:126031242-126031264 AAAAATACAAAAAAGTAGCTGGG + Intergenic
980276978 4:130665566-130665588 AAATATCAAAAAAATTAGCTGGG - Intergenic
980380018 4:132001301-132001323 AAAAATACAAAAAAGTAGCTGGG + Intergenic
980405301 4:132346672-132346694 AAAAATACAGAAAATTAGCTGGG + Intergenic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
980824882 4:138061288-138061310 AAAAATACAAAAAATGAGCTGGG + Intergenic
981110617 4:140929525-140929547 AAAAATACAGAAAATTAGCTGGG - Intronic
981308358 4:143269893-143269915 AAAAATACATAAAAGTAGCTGGG - Intergenic
981321857 4:143400806-143400828 AAAAATACAGAAAATTAGCTGGG + Intronic
981335640 4:143566126-143566148 AAAAATCCAAAAAATTAGCTGGG - Intergenic
981488686 4:145316671-145316693 AGATATCCAGAAAAGCAGATGGG + Intergenic
981557324 4:146008933-146008955 AAAGTTCCAGAAAAAGAGATAGG - Intergenic
982015999 4:151154291-151154313 AAAAATCCAAAAAATTAGCTGGG - Intronic
982125366 4:152179513-152179535 AAATATCCAGAAAAGAAAAATGG - Intergenic
982156059 4:152521978-152522000 AAAAATACAGAAAATTAGCTGGG - Intronic
982757546 4:159240492-159240514 AAAGATACAAAAAAGTAGCTGGG - Intronic
983153259 4:164312481-164312503 AAATATACAAAAAATTAGCTGGG - Intronic
983221934 4:165052334-165052356 AAAAATACAGAAAATTAGCTGGG - Intergenic
983851772 4:172589717-172589739 AAATATTTAGAAAAATAGCTGGG - Intronic
984038430 4:174698337-174698359 AAAAACCCAAAAAAGTAGCTGGG - Intronic
984046525 4:174806510-174806532 AAATATTCAGAAAAAGAGGATGG + Intronic
984223345 4:177004896-177004918 AAATATACAAAAAATTAGCTGGG - Intergenic
984269140 4:177529554-177529576 AAATATACAAAAAATTAGCTGGG - Intergenic
984289894 4:177781871-177781893 GAATCTCCAGAAAAGCAGATTGG - Intronic
984783262 4:183545163-183545185 CAATACACATAAAAGGAGCTGGG + Intergenic
984796319 4:183663392-183663414 AAATATCCAAAAAATTAGCCGGG - Intronic
984958655 4:185071955-185071977 AAAAATCCAGAAAAAGATTTAGG - Intergenic
985123888 4:186671536-186671558 AAAAATACAAAAAATGAGCTGGG + Intronic
985131631 4:186744303-186744325 AATTAGCCAGAAAATGAACTCGG + Intergenic
985956611 5:3270500-3270522 AAAAATCCAAAAAATTAGCTGGG - Intergenic
986145707 5:5075408-5075430 AAAAATACAAAAAAGTAGCTGGG - Intergenic
986466451 5:8030056-8030078 AAATAACAAGAAAATTAGCTGGG + Intergenic
986720815 5:10560330-10560352 AAACATCAAGAATAGGAGATTGG + Intergenic
986824094 5:11501865-11501887 AAAAATCCAAAAAATTAGCTGGG + Intronic
986860277 5:11919488-11919510 AAATATACAAAAAATTAGCTGGG + Intergenic
987346383 5:16982578-16982600 AAAAATACAGAAAATTAGCTGGG - Intergenic
987526320 5:19054605-19054627 AAATATACAAAAAATTAGCTGGG + Intergenic
987638756 5:20583227-20583249 ACAAATCCAGAAAAGTAGCAAGG + Intergenic
988049445 5:26006968-26006990 AAACAACCAGAACAGGAGCCAGG - Intergenic
988146647 5:27317727-27317749 AAAAATACAAAAAATGAGCTAGG + Intergenic
988401705 5:30769901-30769923 AAATTTCTAGAAAAGATGCTAGG - Intergenic
988483952 5:31652849-31652871 AAAAATACAGAAAAGTAGCTGGG + Intronic
988484253 5:31655331-31655353 AAAAATACAGAAAATTAGCTGGG - Intronic
988580732 5:32466604-32466626 AAAAATACAGAAAATTAGCTAGG + Intergenic
989029563 5:37104437-37104459 AAAAATACAGAAAAGTAGCCGGG + Intergenic
989247365 5:39269208-39269230 AAAAATCCAAAAAATTAGCTGGG - Intronic
989774894 5:45193470-45193492 AAATATCCAGAATATAATCTGGG - Intergenic
990394895 5:55367323-55367345 AAAAATACAAAAAATGAGCTGGG + Intronic
990408814 5:55519587-55519609 AAAAATCCAAAAAATTAGCTGGG + Intronic
990768325 5:59213319-59213341 AAAAATCCAAAAAAATAGCTGGG - Intronic
991267304 5:64736620-64736642 AAAAATACAAAAAAGTAGCTGGG - Intronic
991326867 5:65443459-65443481 AAATATACAAAAAATTAGCTGGG + Intronic
991405261 5:66294994-66295016 GAATGTCCAGAACAGGAGCATGG + Intergenic
991592813 5:68272091-68272113 AAATATACAAAAAATTAGCTGGG + Intronic
991706545 5:69363621-69363643 AAAAATACAGAAAATTAGCTGGG + Intronic
991734655 5:69620726-69620748 AAAAATACAAAAAAGTAGCTGGG - Intergenic
991780323 5:70125995-70126017 AAAAATACAAAAAAGTAGCTGGG + Intergenic
991811089 5:70475867-70475889 AAAAATACAAAAAAGTAGCTGGG - Intergenic
991859610 5:71001409-71001431 AAAAATACAAAAAAGTAGCTGGG + Intronic
991872770 5:71126306-71126328 AAAAATACAAAAAAGTAGCTGGG + Intergenic
992014986 5:72566627-72566649 AAAAATACAAAAAAGTAGCTGGG + Intergenic
992108108 5:73467160-73467182 AAAAATACAAAAAAGTAGCTAGG + Intergenic
992126839 5:73650807-73650829 AAAAATACAAAAAACGAGCTGGG - Intronic
992718496 5:79535139-79535161 AAAAATACAGAAAATTAGCTGGG - Intergenic
992766533 5:80006117-80006139 AGATTTCCAGAAAAGGAATTGGG + Intronic
992805235 5:80330991-80331013 AAATATACAAAAAATTAGCTGGG + Intergenic
992907411 5:81359676-81359698 AGATCTCCAGGAAAGGAGATGGG - Intronic
992918251 5:81482100-81482122 AAAGATACAGAAAATTAGCTGGG - Intronic
993094351 5:83464469-83464491 AAGTACCAAGAAAGGGAGCTAGG + Intergenic
993150059 5:84149916-84149938 AAATATACAGAAAAAAATCTGGG + Intronic
993158598 5:84259118-84259140 AAAAATACAGAAAATTAGCTGGG - Intronic
993161414 5:84297019-84297041 AAATATACAAAAAATTAGCTGGG + Intronic
993204255 5:84860463-84860485 AAATATACAAAAAATTAGCTGGG + Intergenic
993373336 5:87118988-87119010 AAATATACAAAAAATTAGCTGGG - Intergenic
993430122 5:87822704-87822726 AAATATCAACAAAATTAGCTGGG - Intergenic
993495146 5:88600526-88600548 AAAAATACAAAAAAGTAGCTGGG - Intergenic
993854569 5:93057242-93057264 GAGTATCCAGAAGAGGAGCCAGG + Intergenic
994174316 5:96694468-96694490 AAATATACAAAAAATTAGCTGGG + Intronic
994587318 5:101725694-101725716 AAAAATGCAGAAAATTAGCTGGG + Intergenic
994797387 5:104320426-104320448 AAAAATACAGAAAATTAGCTGGG - Intergenic
995164185 5:109018819-109018841 AAATATCCAGAAAACGATGTGGG - Intronic
995208579 5:109510889-109510911 AAACATCAAGAAAAGGGGCAAGG - Intergenic
995354276 5:111220459-111220481 AAATGACCAGAAAAGGAACAGGG - Intergenic
995434419 5:112119807-112119829 ATCTCTCCAGAAAAGGAACTGGG + Intergenic
995832352 5:116367142-116367164 AAATTTACAAAAAGGGAGCTGGG - Intronic
996302305 5:122003182-122003204 AAACATCCAAAAAATAAGCTGGG + Intronic
996706008 5:126499459-126499481 AGAGATCCAGAAATGGTGCTGGG - Intergenic
997167278 5:131674555-131674577 AAAAATACAGAAAATTAGCTGGG + Intronic
997403420 5:133621237-133621259 AAAAATACAAAAAATGAGCTGGG + Intergenic
998554349 5:143108689-143108711 AAATCCCCACAAAAGGAGATAGG + Intronic
998741917 5:145213342-145213364 AAAAATACAGAAAATTAGCTGGG + Intergenic
999028567 5:148263635-148263657 AAAAATACAGAAAATTAGCTGGG - Intergenic
999126296 5:149248528-149248550 AAAAATACAGAAAATTAGCTGGG + Intronic
999161182 5:149500436-149500458 AAAAATACAAAAAAGTAGCTGGG - Intronic
999181467 5:149672634-149672656 AAAAATACAAAAAAGTAGCTGGG + Intergenic
999220905 5:149976646-149976668 AAATAGCCAGAAAAAGAGAAAGG - Intronic
999949156 5:156630020-156630042 AAAAATACAGAAAATTAGCTGGG - Intronic
1000047525 5:157533806-157533828 AAATATACAAAAAATTAGCTGGG + Intronic
1000065131 5:157687678-157687700 AAAAATACAAAAAATGAGCTGGG + Intergenic
1000176639 5:158762694-158762716 AAAAATACAAAAAAGTAGCTGGG - Intronic
1000321983 5:160141762-160141784 AAAAATACAGAAAATTAGCTGGG + Intergenic
1000543558 5:162570469-162570491 AAACATCCAGAAAAGAGGCAGGG - Intergenic
1000866922 5:166525252-166525274 AAATAACCAGAAAAGGAGACTGG + Intergenic
1000889524 5:166786420-166786442 CAATCTCCAGCAGAGGAGCTGGG + Intergenic
1000897016 5:166867442-166867464 AAAAATGGAGAAAAGGGGCTGGG - Intergenic
1000982758 5:167834306-167834328 AAATCCCCATAAAAGGAGCCAGG - Intronic
1000992616 5:167926558-167926580 AAAAATCCAAAATAGTAGCTGGG + Intronic
1001036893 5:168303446-168303468 AAACATTCAAAAAATGAGCTGGG + Intronic
1001235662 5:170027250-170027272 AAATATTCGGATTAGGAGCTAGG + Intronic
1001250840 5:170145701-170145723 AAGTATCCTTAAAAGGAGCTAGG + Intergenic
1001372911 5:171224340-171224362 AAAGATCCAGAAAAAGGGGTAGG - Intronic
1001404590 5:171467011-171467033 AAATAAACAGAAAAGGAACTGGG + Intergenic
1001458775 5:171889725-171889747 AAAAATACAAAAAAGTAGCTGGG + Intronic
1001471471 5:172016272-172016294 AAAAATACAGAAAATTAGCTGGG + Intergenic
1001490259 5:172149884-172149906 AAATATACAAAAAATTAGCTGGG + Intronic
1001528412 5:172445367-172445389 AAAAATCCACAAAATTAGCTGGG - Intronic
1001540191 5:172532476-172532498 AAAAATACAGAAAATTAGCTAGG - Intergenic
1001600927 5:172927738-172927760 AAAAATACAGAAAATTAGCTGGG - Intronic
1001613087 5:173019392-173019414 AAAAATACAAAAAATGAGCTGGG + Intronic
1001811798 5:174634698-174634720 AAATATTAATAAAAGGAGCAAGG + Intergenic
1001846810 5:174929424-174929446 AAAAATACAGAAAATTAGCTGGG - Intergenic
1001852738 5:174983812-174983834 AAATATACAAAAAATTAGCTGGG + Intergenic
1001975788 5:175997280-175997302 AAATATACAAAAAATTAGCTGGG + Intronic
1001992512 5:176129721-176129743 AAAAATACAGAAAAGTAGCCAGG - Intronic
1002002235 5:176203138-176203160 AAAAATACAGAAAAGTAGCCAGG - Intergenic
1002008430 5:176255420-176255442 AAAAATACAAAAAATGAGCTGGG + Intronic
1002218289 5:177656850-177656872 AAAAATACAAAAAATGAGCTGGG - Intergenic
1002241638 5:177846492-177846514 AAATATACAAAAAATTAGCTGGG - Intergenic
1002627299 5:180539012-180539034 AAAAATACAAAAAATGAGCTGGG + Intronic
1002651928 5:180704177-180704199 AATTATACAGAAAAGTAGCTGGG - Intergenic
1002672397 5:180878664-180878686 AAAAATACAGAAAATTAGCTGGG - Intergenic
1002812375 6:643404-643426 CAATATCCAGAAAAGTATCCAGG + Intronic
1002995296 6:2277464-2277486 AAAAATACAGAAAATTAGCTGGG - Intergenic
1003482825 6:6548738-6548760 AAAAATACAAAAAATGAGCTGGG + Intergenic
1003531251 6:6939489-6939511 AAAAATGCAGAAAATTAGCTGGG + Intergenic
1003617174 6:7665999-7666021 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1003983774 6:11415841-11415863 AAAAATACAAAAAATGAGCTGGG - Intergenic
1004210038 6:13630968-13630990 AAAAATACAAAAAAGTAGCTGGG - Intronic
1004381859 6:15139346-15139368 AAAGATACAGAAAATTAGCTGGG - Intergenic
1004644320 6:17544712-17544734 AAATATTCAAAAAATTAGCTGGG - Intronic
1004709991 6:18160575-18160597 AAATATGCAAAAAATTAGCTGGG + Intronic
1004724923 6:18302165-18302187 AAATATACAAAAAATTAGCTGGG - Intergenic
1004748783 6:18539610-18539632 AAATATCCAAAAAAAGGACTGGG - Intergenic
1004777789 6:18868051-18868073 AAAAATACAAAAAAGGAGCTGGG + Intergenic
1004876749 6:19963578-19963600 AAATATACAAAAAATTAGCTGGG - Intergenic
1004891629 6:20106581-20106603 AATTATACAAAAAAGTAGCTGGG - Intronic
1004967813 6:20874660-20874682 AAAAATACAGAAAATCAGCTGGG - Intronic
1005026871 6:21471224-21471246 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1005567450 6:27111152-27111174 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1005569912 6:27134772-27134794 AAAAATACAAAAAAGTAGCTGGG - Exonic
1005685021 6:28245909-28245931 AAGCTTCCAGAAAAGGAGCATGG - Exonic
1005750080 6:28874069-28874091 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1005827991 6:29647114-29647136 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1006269215 6:32950993-32951015 AAAAATACAAAAAAGTAGCTGGG + Intronic
1006308713 6:33241701-33241723 AAATATACAAAAAAATAGCTGGG + Intergenic
1006759557 6:36447467-36447489 AAAAATTCAGAAAATTAGCTGGG + Intronic
1006785009 6:36660595-36660617 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1006858465 6:37152925-37152947 AAAAATACAGAAAATGAGCTGGG + Intergenic
1006915769 6:37593039-37593061 AAAAATACAGAAAATTAGCTGGG + Intergenic
1006948296 6:37800341-37800363 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1006958017 6:37894092-37894114 AAAAATACAGAAAATTAGCTGGG + Intronic
1007054164 6:38865277-38865299 AAACATCCAGTAAAGCAGTTAGG + Intronic
1007547635 6:42706242-42706264 AAATATACAAAAAATTAGCTGGG + Intronic
1007549649 6:42719333-42719355 AAAAATACAGAAAATTAGCTGGG - Intronic
1007577458 6:42935023-42935045 AAAAATACAGAAAATTAGCTGGG - Intronic
1007648672 6:43402557-43402579 AAAAATACAAAAAATGAGCTGGG + Intergenic
1007667451 6:43523666-43523688 AAGTATCAAGAAAGGGAGTTAGG - Exonic
1007868868 6:45008898-45008920 AAAAATACAAAAAATGAGCTGGG - Intronic
1008221770 6:48863059-48863081 AAATATACAAAAAAGTAGCCAGG + Intergenic
1008269110 6:49468431-49468453 AAAAATACAGAAAATTAGCTGGG + Intronic
1008345489 6:50421577-50421599 AAAAATACAAAAAATGAGCTGGG + Intergenic
1008360771 6:50615335-50615357 AAATATACAAAAAATTAGCTGGG + Intergenic
1008503462 6:52206544-52206566 AAAAATCCAAAAAAGTAGCCAGG + Intergenic
1008563091 6:52740941-52740963 AAATATCCAAAAACGGAGGGTGG - Intergenic
1008690164 6:53969869-53969891 AAATATACAAAAAATTAGCTGGG + Intronic
1008704953 6:54146205-54146227 AAATATGCAAGAAAGGAGGTTGG - Intronic
1009639783 6:66319039-66319061 AAAGATACAGAAAATTAGCTGGG - Intergenic
1010026089 6:71218965-71218987 AAATAAACAAAAAAGTAGCTAGG + Intergenic
1010226196 6:73491725-73491747 AATTCTCCAGATAAGGAGTTGGG + Intronic
1010272915 6:73934990-73935012 AAATATACAAAAAATTAGCTGGG + Intergenic
1010446345 6:75952982-75953004 AAATATCCACAAACAGATCTGGG + Intronic
1010715407 6:79223348-79223370 AAATATACAAAAAATTAGCTGGG + Intronic
1010790298 6:80056119-80056141 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1011058264 6:83230770-83230792 AAATATACAAAAAATTAGCTGGG + Intronic
1011132377 6:84064646-84064668 AAAAATACAAAAAAGTAGCTGGG - Intronic
1011369323 6:86616208-86616230 AAAAATACAAAAAATGAGCTGGG - Intergenic
1011518957 6:88183104-88183126 AAATAACCACAAAATGTGCTTGG + Intergenic
1011666748 6:89641884-89641906 AAAAATACAGAAAATTAGCTGGG - Intergenic
1011667711 6:89651162-89651184 AAAAATACAGAAAATTAGCTGGG + Intronic
1011690829 6:89866821-89866843 AAATAGTCAGAAAAGGAGTGTGG + Exonic
1013020149 6:106206487-106206509 AAAAATACAGAAAATTAGCTGGG + Intronic
1013057123 6:106594346-106594368 AAAAATACAAAAAAGTAGCTGGG + Intronic
1013064557 6:106670998-106671020 AAAAATACAGAAAATGAGCTGGG + Intergenic
1013248262 6:108308864-108308886 AAAAATACAAAAAAGCAGCTGGG - Intronic
1013774158 6:113660688-113660710 AAATATACAAAAAATTAGCTGGG - Intergenic
1013815370 6:114091521-114091543 AAAAATACAGAAAATTAGCTGGG + Intronic
1013832823 6:114294604-114294626 AAAAATACAGAAAATTAGCTGGG - Intronic
1013835836 6:114334193-114334215 AAACATCCAGAAAAGGCTCAAGG - Intronic
1014095425 6:117454460-117454482 AAATATACAAAAAATTAGCTGGG + Intronic
1014530413 6:122552535-122552557 AAAAATACAAAAAAGTAGCTGGG - Intronic
1014906417 6:127034817-127034839 AAATATATAGAAAAGGAAGTAGG + Intergenic
1015094769 6:129402046-129402068 AAATATTCAAAAAATTAGCTGGG + Intronic
1015146521 6:129993678-129993700 AAAAATACAGAAAATTAGCTGGG - Intergenic
1015531435 6:134225188-134225210 AAAGATACAGAAAATGAGCCTGG + Intronic
1015548215 6:134384373-134384395 AAAAATGCAGAAAATTAGCTGGG + Intergenic
1015755330 6:136600350-136600372 AAAAATACAGAAAAATAGCTGGG - Intronic
1015847512 6:137536177-137536199 TAATAACCAGAAAAGAAACTGGG + Intergenic
1016000903 6:139040212-139040234 AAAAATGCAGAAAAGGAGGCTGG + Intronic
1016049113 6:139511807-139511829 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1016370039 6:143364361-143364383 AAAAATCCAGAACAGGGGCAGGG + Intergenic
1016960392 6:149667273-149667295 AAAAATACAGAAAATTAGCTGGG + Intronic
1017083615 6:150693002-150693024 AAATGTCAAGATAAGGAGCTTGG + Intronic
1017357712 6:153529245-153529267 AAAAATACAAAAAATGAGCTGGG - Intergenic
1017953587 6:159159603-159159625 AAAAATACAAAAAATGAGCTGGG + Intergenic
1018085106 6:160294679-160294701 AAAAATTCAGAAAATTAGCTTGG - Intergenic
1018544947 6:164925055-164925077 AAAGAGCCTGAAAAGGAACTTGG + Intergenic
1019110957 6:169713437-169713459 AAATATACAGAAAATTAGCTGGG + Intronic
1019582449 7:1772183-1772205 AAAAATACAGAAAATTAGCTGGG + Intergenic
1019673818 7:2298850-2298872 AAAAATCCAAAAAATTAGCTAGG - Intronic
1019683748 7:2368302-2368324 AAATATACAAAAAATTAGCTGGG - Intronic
1019761651 7:2817263-2817285 AAAAATACAAAAAATGAGCTGGG - Intronic
1019825004 7:3276937-3276959 AAAAATACAGAAAATTAGCTGGG - Intergenic
1020033213 7:4947552-4947574 AAAAATACAAAAAAGTAGCTGGG - Intronic
1020217681 7:6207253-6207275 AAAAATACAGAAAATTAGCTGGG - Intronic
1020423944 7:8042393-8042415 AAATATCATTAACAGGAGCTTGG + Intronic
1021038421 7:15830107-15830129 AAATATCCTGAAACTGAGATAGG + Intergenic
1021269613 7:18569417-18569439 AACTATGCAGAACAGGAGTTAGG - Intronic
1021348618 7:19559806-19559828 AAATATAAAAAAAAAGAGCTTGG - Intergenic
1021471180 7:21003574-21003596 AAATATGCTGAAAGGGACCTGGG + Intergenic
1021489020 7:21198085-21198107 AAATATACAAAAAATCAGCTGGG + Intergenic
1021873020 7:25022194-25022216 AAAAATACAGAAAATTAGCTGGG - Intergenic
1021895569 7:25232114-25232136 AAAGATCAAGAAAAGGATCTAGG - Intergenic
1022054311 7:26713758-26713780 AAAAATACAAAAAATGAGCTGGG - Intronic
1022147368 7:27558486-27558508 AAAAATACAAAAAAGTAGCTGGG - Intronic
1022196022 7:28068072-28068094 AAATATACAAAAAATTAGCTGGG - Intronic
1022597527 7:31726871-31726893 AAAAATACAGAAAATTAGCTGGG + Intergenic
1022686975 7:32606208-32606230 AAATATCTTGAAAAGGACCCAGG - Intergenic
1022814123 7:33897703-33897725 AAATATTCAGCAAAGGTGTTGGG + Intergenic
1022904692 7:34844380-34844402 AACTCTCCAAAATAGGAGCTTGG - Intronic
1023024231 7:36036443-36036465 AAAAAAAAAGAAAAGGAGCTGGG - Intergenic
1023414055 7:39915895-39915917 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1023545991 7:41318076-41318098 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1023954949 7:44877641-44877663 AAAAATACAGAAAATTAGCTGGG + Exonic
1023956123 7:44888148-44888170 AAGAAACCAGAGAAGGAGCTGGG - Intergenic
1023985281 7:45090309-45090331 AAAAATACAGAAAATGAGCCGGG + Intergenic
1024323748 7:48092861-48092883 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1024449134 7:49518474-49518496 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1024850076 7:53703038-53703060 AAATATACAAAAAATTAGCTGGG - Intergenic
1025076438 7:55947759-55947781 AAAAATACACAAAAGTAGCTGGG - Intergenic
1025170450 7:56751805-56751827 AAATATACAAAAAATTAGCTGGG - Intergenic
1025202784 7:56972302-56972324 AAATATACAAAAAATTAGCTGGG + Intergenic
1025627724 7:63236804-63236826 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1025669160 7:63604624-63604646 AAATATACAAAAAATTAGCTGGG - Intergenic
1025701435 7:63823894-63823916 AAATATACAAAAAATTAGCTGGG + Intergenic
1025841243 7:65151675-65151697 AAAAATACAAAAAATGAGCTGGG - Intergenic
1025865695 7:65378579-65378601 AAAAATACAAAAAAGTAGCTGGG + Intronic
1025881801 7:65544270-65544292 AAAAATACAAAAAATGAGCTGGG + Intergenic
1025891640 7:65658362-65658384 AAAAATACAAAAAATGAGCTGGG - Intergenic
1025935950 7:66037440-66037462 AAATATACAAAAAAATAGCTGGG + Intergenic
1025966586 7:66278621-66278643 AAATATACAAAAAAGTAGCTGGG + Intronic
1026119092 7:67521073-67521095 AAAAATACAGAAAATTAGCTGGG - Intergenic
1026630249 7:72031900-72031922 AAAAATACAAAAAATGAGCTGGG - Intronic
1026967154 7:74447537-74447559 AAAAATACAGAAAATCAGCTGGG + Intergenic
1027024999 7:74844846-74844868 AAAAATGCAGAAAATGAGCTGGG - Intronic
1027059817 7:75076105-75076127 AAATATGCAAAAAATTAGCTGGG + Intergenic
1027062765 7:75099273-75099295 AAAAATGCAGAAAATGAGCTGGG + Intronic
1027164383 7:75824045-75824067 AAATATGCAAAAAATTAGCTGGG - Intergenic
1027305633 7:76893286-76893308 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1027360892 7:77408538-77408560 AAAAATACAGAAAATTAGCTGGG + Intronic
1027631158 7:80607929-80607951 AAAAATACAGAAAATTAGCTGGG - Intronic
1027660199 7:80979783-80979805 AAAAATACAAAAAATGAGCTGGG - Intergenic
1028054835 7:86228130-86228152 AAAAATACAAAAAATGAGCTGGG - Intergenic
1028192527 7:87869365-87869387 AAAAATACAAAAAATGAGCTAGG + Intronic
1028388173 7:90283926-90283948 AAGTATATTGAAAAGGAGCTAGG + Intronic
1028834144 7:95355957-95355979 AAATATACAAAAAATTAGCTGGG - Intergenic
1028995622 7:97096625-97096647 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1029022387 7:97378397-97378419 AAAAATACAGAAAATTAGCTGGG - Intergenic
1029100409 7:98125140-98125162 AAATATACAAAAAATTAGCTGGG + Intronic
1029287395 7:99475231-99475253 AAAAATACAAAAAAGTAGCTGGG + Intronic
1029358995 7:100074429-100074451 AAATATCCAAAAAATTAGCCAGG - Intronic
1029377418 7:100187915-100187937 AAAAATGCAAAAAATGAGCTGGG - Intronic
1029732758 7:102448548-102448570 AAAAATACAGAAAATTAGCTGGG + Exonic
1029839044 7:103343158-103343180 AAAAATACAAAAAAGTAGCTGGG - Intronic
1029971237 7:104791521-104791543 AAAGATCCAGAAAAACAGATGGG - Intronic
1030058413 7:105603150-105603172 AAAAATACAAAAAATGAGCTGGG - Intergenic
1030171788 7:106609980-106610002 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1030229972 7:107197527-107197549 AAATATGCAAAAAATTAGCTGGG - Intronic
1030279946 7:107763166-107763188 TTATATCCAGAAAAGCTGCTAGG - Intergenic
1030379516 7:108796358-108796380 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1030866613 7:114708193-114708215 AAATATACAAAAAATTAGCTGGG - Intergenic
1031143371 7:117970554-117970576 AAATATACAAAAAATTAGCTGGG + Intergenic
1031191478 7:118557561-118557583 AAAAATACAAAAAAGTAGCTTGG + Intergenic
1031930751 7:127683374-127683396 AAAAATCAAAAAAAGTAGCTGGG - Intronic
1032169037 7:129568996-129569018 AAAAAAACAGAAAAGGGGCTGGG + Intergenic
1032315390 7:130833476-130833498 AAAAATACAAAAAATGAGCTGGG - Intergenic
1032335712 7:131022712-131022734 AAAAATACAGAAAATTAGCTGGG - Intergenic
1032774504 7:135096889-135096911 AAATATGCAGAAAAGAATTTGGG + Intronic
1032836588 7:135680807-135680829 AAAAATACAGAAAACCAGCTGGG + Intronic
1033182691 7:139196327-139196349 AAAAATACAAAAAATGAGCTGGG - Intergenic
1033303588 7:140208349-140208371 AAAAATACAGAAAATTAGCTGGG - Intergenic
1033314876 7:140288770-140288792 AAATATACAAAAAATTAGCTGGG + Intergenic
1033332610 7:140428889-140428911 AAAAATACAGAAAATTAGCTGGG - Intergenic
1033384560 7:140859846-140859868 AAAAATACAGAAAATTAGCTGGG - Intronic
1033389575 7:140913641-140913663 AAATATACAAAAAATTAGCTGGG - Intronic
1034006318 7:147476264-147476286 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034021190 7:147644459-147644481 AAAAATACAGAAAATTAGCTGGG + Intronic
1034082072 7:148288258-148288280 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034095258 7:148401757-148401779 AAAAATACAAAAAAGTAGCTGGG - Intronic
1034691669 7:153019001-153019023 AAAAATCCAGCAAGGGAGCGAGG - Intergenic
1034710138 7:153184003-153184025 AAATATACAAAAAAGTAGCTGGG + Intergenic
1034864410 7:154628656-154628678 AACTATCCAAAGAAGGATCTGGG + Intronic
1034908253 7:154970593-154970615 AAAAATCCAGAAAAGAAGATGGG + Intronic
1035481461 7:159190646-159190668 AAAAATACAGAAAATTAGCTGGG + Intergenic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1035991455 8:4495412-4495434 AAAAATACAGAAAATTAGCTAGG + Intronic
1036068987 8:5419230-5419252 AAATATGCAGAACAGGAGTAAGG - Intergenic
1036076259 8:5504502-5504524 AAAAATACACAAAAGTAGCTCGG - Intergenic
1036159657 8:6375350-6375372 AAATATACAAAAAATTAGCTGGG - Intergenic
1036389936 8:8316679-8316701 TAATATGCAGAAGAGGACCTGGG + Intergenic
1036405543 8:8451780-8451802 AAATATACAAAAAAATAGCTGGG + Intergenic
1036458881 8:8934426-8934448 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1036513952 8:9426338-9426360 AAAAATACAGAAAATTAGCTGGG + Intergenic
1036523346 8:9512717-9512739 AAATATACAAAAAATTAGCTGGG - Intergenic
1036721911 8:11183616-11183638 AAAAATCCAGAAAATAAGCCAGG - Intronic
1036913151 8:12776050-12776072 AAAGATCTGGAAAAGGAACTTGG + Intergenic
1037038757 8:14203955-14203977 AATTATCTAGGAAAGGAGTTGGG + Intronic
1037314703 8:17590068-17590090 AAAAATACAGAAAATTAGCTGGG + Intronic
1037332641 8:17759040-17759062 AAAAATACAGAAAATGAGCCGGG - Intronic
1037337691 8:17807515-17807537 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1037360525 8:18068978-18069000 AAAAATTCAGAAAAGTAGCTGGG + Intronic
1037593248 8:20331167-20331189 AAAAATACAGAAAATTAGCTGGG + Intergenic
1038038924 8:23707614-23707636 AGATCTCCAGAAAAGGCCCTTGG + Intergenic
1038260795 8:25992177-25992199 AAAAATACAGAAAATTAGCTGGG + Intronic
1038288093 8:26224291-26224313 AAAAATCCAGAAAAGGGGCTGGG + Intergenic
1038362613 8:26897466-26897488 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1038559528 8:28559876-28559898 AATTATCCAGCAAAGAATCTGGG - Intronic
1038567855 8:28634753-28634775 AAAAATACAGAAAATTAGCTGGG - Intronic
1038632494 8:29259438-29259460 AAATATCTATAAAAGGTGTTTGG - Intronic
1038830189 8:31049048-31049070 AAAAATACAGAAAATGAGCCGGG + Intronic
1039149914 8:34492659-34492681 AAAAATACAAAAAATGAGCTGGG + Intergenic
1039212204 8:35230310-35230332 AAATCTACAGAAAATTAGCTGGG + Intergenic
1039696196 8:39914924-39914946 AAAAATACAAAAAAGTAGCTGGG - Intronic
1039697251 8:39926024-39926046 AAAAATACAAAAAAGTAGCTGGG + Intronic
1039942166 8:42100415-42100437 AAAAATACAGAAAATTAGCTGGG + Intergenic
1039978851 8:42390051-42390073 AAAAATACAGAAAATTAGCTGGG - Intergenic
1040398063 8:47018691-47018713 AACTATCCATAAAAGGAGGGAGG + Intergenic
1040501676 8:48010560-48010582 AAATATACAAAAAATTAGCTGGG - Intronic
1040620852 8:49090943-49090965 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1040975629 8:53191175-53191197 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1041042220 8:53858861-53858883 AAATATCCAGCAATGGAACTGGG + Intronic
1041432393 8:57797650-57797672 AAATATCATTAACAGGAGCTTGG + Intergenic
1041598135 8:59681952-59681974 AAATATCCAGAATGGAGGCTGGG + Intergenic
1041601751 8:59726146-59726168 AAATACCTAGAAAAGCAGTTTGG - Intergenic
1041616637 8:59915155-59915177 AAACATACAGAAAATTAGCTGGG + Intergenic
1041693437 8:60712888-60712910 AAAAATACAAAAAAGTAGCTGGG + Intronic
1041915129 8:63131416-63131438 AAATATCCAAAAAATTAGCTGGG - Intergenic
1042092718 8:65176484-65176506 AAAAATACAGAAAATTAGCTCGG + Intergenic
1042411520 8:68472040-68472062 AAAAAGCCAGAAAAAGAGCATGG - Intronic
1042563912 8:70094355-70094377 AAAAATACAGAAAATTAGCTGGG + Intergenic
1042772674 8:72396479-72396501 AAAAATACAGAAAATTAGCTGGG + Intergenic
1043452302 8:80380333-80380355 AAAAATACAGAAAATTAGCTGGG - Intergenic
1043809463 8:84718602-84718624 AAAAATACAGAAAATTAGCTGGG + Intronic
1043843786 8:85140901-85140923 AAAAATACAGAAAATTAGCTGGG + Intronic
1043874466 8:85468597-85468619 AAAAATGCAAAAAATGAGCTAGG + Intronic
1044218873 8:89646556-89646578 AAATATACAGAAAATTAGCTGGG - Intergenic
1044226097 8:89720049-89720071 TATTATTCAGAAAAGGAACTAGG + Intergenic
1044498089 8:92915163-92915185 AAATATGTAGAAAAGGAGAGTGG + Intronic
1044789913 8:95836737-95836759 AATTAACAAGAAATGGAGCTAGG + Intergenic
1044970679 8:97616522-97616544 AAAAATACAGAAAATTAGCTGGG + Intergenic
1045200314 8:99973706-99973728 AAAAATCCAAAAAATTAGCTGGG + Intronic
1045245827 8:100441082-100441104 AAAAATACAGAAAATTAGCTGGG - Intergenic
1045285366 8:100786044-100786066 AAATATACAAAAAATTAGCTGGG + Intergenic
1045290943 8:100832180-100832202 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1045859392 8:106798466-106798488 AAAAATACAGAAAATCAGCTGGG - Intergenic
1046055556 8:109074162-109074184 AAATATGAAGAAAAGCAGCGAGG - Intergenic
1046096494 8:109568490-109568512 AAATATGAAGAAAATTAGCTTGG + Intergenic
1047375717 8:124294216-124294238 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1047494407 8:125399344-125399366 AAAAATCAAGAAAATTAGCTGGG - Intergenic
1047756324 8:127921651-127921673 AAAAATACAGAAAATTAGCTGGG + Intergenic
1047977488 8:130145476-130145498 AAAAATACAGAAAAGTAGCCGGG - Intronic
1048004007 8:130403711-130403733 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1048080461 8:131121106-131121128 AAAAATACAGAAAATTAGCTGGG - Intergenic
1048557441 8:135494437-135494459 AAAAATGCAAAAAAGTAGCTGGG - Intronic
1048748787 8:137647347-137647369 AAAAATACAAAAAATGAGCTGGG + Intergenic
1049318346 8:141981620-141981642 AGATATCCAGAAAGAGAACTTGG + Intergenic
1049366924 8:142243890-142243912 AAATATACAAAAAAGAAGCCGGG + Intronic
1049826070 8:144669344-144669366 AAAAATACAGAAAATTAGCTGGG + Intergenic
1050385802 9:5089375-5089397 AAATATACAAAAAATTAGCTGGG + Intronic
1050732948 9:8730093-8730115 AAATATACAGAAAATTAGCCGGG + Intronic
1050773851 9:9236102-9236124 AAAAATACAAAAAAGTAGCTGGG + Intronic
1050913735 9:11105881-11105903 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1050917197 9:11151485-11151507 AAACATCTAGAAAATGAGTTGGG - Intergenic
1051284658 9:15483830-15483852 AAATATACAAAAAATTAGCTGGG + Intronic
1051304344 9:15692686-15692708 AAATATACAAAAAATTAGCTGGG - Intronic
1051400647 9:16678426-16678448 AAAAATACAGAAAATTAGCTGGG - Intronic
1051415606 9:16836849-16836871 AAAGATTCAGAAAAGGCCCTTGG + Intronic
1051498762 9:17754510-17754532 AAATATACAAAAAATTAGCTGGG + Intronic
1051571835 9:18567303-18567325 AAAAATACAGAAAAGTAGCCAGG + Intronic
1051985355 9:23078869-23078891 TAATATACAGAAAAAAAGCTTGG - Intergenic
1052477156 9:28974243-28974265 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1052507242 9:29371450-29371472 AAAAATACAGAAAATGAGCCGGG - Intergenic
1052657292 9:31378879-31378901 AAAAATCCAAAAAAGTAGCTGGG - Intergenic
1052793243 9:32897738-32897760 AAAAATACAGAAAATTAGCTGGG + Intergenic
1052934074 9:34078579-34078601 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1053215665 9:36268504-36268526 AAAAATACAGAAAATTAGCTGGG + Intronic
1053399951 9:37809989-37810011 AAAAATACAAAAAAGTAGCTGGG + Intronic
1053574209 9:39342243-39342265 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053625296 9:39864654-39864676 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053690274 9:40583493-40583515 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1053838772 9:42170491-42170513 AAATATGAATAAAAAGAGCTAGG + Intergenic
1053879572 9:42578572-42578594 AAATATGAATAAAAAGAGCTAGG - Intergenic
1053893092 9:42715765-42715787 AAATATCAATAAAAAGAGCTAGG + Intergenic
1054095772 9:60900935-60900957 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054117234 9:61176874-61176896 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054218595 9:62386040-62386062 AAATATGAATAAAAAGAGCTAGG - Intergenic
1054232120 9:62523127-62523149 AAATATGAATAAAAAGAGCTAGG + Intergenic
1054301525 9:63384454-63384476 AACTAGGCAGAAAAGGAGCAAGG + Intergenic
1054590525 9:67005694-67005716 AAATATGAATAAAAAGAGCTAGG - Intergenic
1054791181 9:69258238-69258260 AAAAATACAGAAAATTAGCTGGG + Intergenic
1054850171 9:69839585-69839607 AAAAATACAGAAAATTAGCTGGG - Intronic
1054850225 9:69839914-69839936 AAAAATACAGAAAATTAGCTGGG + Intronic
1055026681 9:71729456-71729478 AAAAATACAGAAAATTAGCTGGG + Intronic
1055110368 9:72553266-72553288 AAATATACAGAATTGGAGCCAGG - Intronic
1055317457 9:75048257-75048279 AAAAATACAGAAAATTAGCTGGG + Intergenic
1055361180 9:75492011-75492033 AAATATTCATAAAGGGAGCTGGG - Intergenic
1055407949 9:75994581-75994603 AAAAATACAAAAAAGTAGCTGGG - Intronic
1055484318 9:76742455-76742477 AAAGATCAAGAAAATTAGCTAGG + Intronic
1055541510 9:77311083-77311105 AAAAATACAAAAAAGTAGCTGGG - Intronic
1055723047 9:79197210-79197232 AAAAATACAGAAAATTAGCTGGG - Intergenic
1056429773 9:86515588-86515610 AAAAATACACAAAAGAAGCTTGG - Intergenic
1056455103 9:86752303-86752325 AAATATACAAAAAATTAGCTGGG + Intergenic
1057105481 9:92411131-92411153 AAAAATACAAAAAAGTAGCTGGG - Intronic
1057228099 9:93303077-93303099 AAAAATACAAAAAAGTAGCTGGG - Intronic
1057338581 9:94178357-94178379 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1057339373 9:94185777-94185799 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1057414487 9:94848935-94848957 AAATACCAAGAAAATTAGCTGGG - Intronic
1057473163 9:95376028-95376050 AAAGATACAAAAAATGAGCTGGG - Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1058306124 9:103442652-103442674 AAAAATACAGAAAATTAGCTGGG + Intergenic
1058339691 9:103879357-103879379 AAACATACAGAAAATTAGCTGGG + Intergenic
1058430511 9:104914315-104914337 AAAAATACAAAAAAGTAGCTGGG + Intronic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059291634 9:113230416-113230438 AAAAATCAAGAAAAGTAGCCAGG - Intronic
1059334628 9:113561182-113561204 AAAAATACAAAAAAGTAGCTGGG - Intronic
1059354587 9:113688722-113688744 GAATAGCCTGAAAAGGAGGTGGG - Intergenic
1059373947 9:113867036-113867058 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1059682785 9:116602767-116602789 AAAAATACAAAAAATGAGCTGGG + Intronic
1059777456 9:117489690-117489712 AAATACCAAGCTAAGGAGCTAGG - Intergenic
1059881843 9:118699456-118699478 AAAAATACAGAAAATTAGCTAGG - Intergenic
1059936456 9:119316245-119316267 AAATATACAAAAAATGAGATGGG - Intronic
1060564353 9:124576673-124576695 AAAAATCCAGTAAAGTAGATAGG - Intronic
1060595578 9:124846361-124846383 AAAAATACAAAAAATGAGCTGGG - Intergenic
1060753132 9:126187669-126187691 AAAAATACAGAAAATTAGCTGGG - Intergenic
1060786558 9:126455643-126455665 AAATATCAAAAAAATCAGCTGGG - Intronic
1060872600 9:127054816-127054838 AAATATTCACAAAATTAGCTGGG + Intronic
1060891648 9:127193041-127193063 AAAGATCCAGTGAAGGACCTTGG + Intronic
1060986383 9:127821568-127821590 AAAAATACAAAAAAGTAGCTAGG + Intronic
1061120378 9:128638354-128638376 AAAAATACAAAAAATGAGCTGGG + Intronic
1061142726 9:128778221-128778243 AAATATACAAAAAAGTAGCTGGG + Intergenic
1061294851 9:129671499-129671521 AAAACTCCAGAAAAGCAGCTTGG + Intronic
1203709122 Un_KI270742v1:80269-80291 AAAAATACAGAAAATTAGCTGGG - Intergenic
1185686519 X:1933388-1933410 AAAAATGCAAAAAAGTAGCTGGG + Intergenic
1185923043 X:4115118-4115140 AAAAATACAAAAAAGCAGCTGGG - Intergenic
1186493689 X:9995013-9995035 AAATATACAGAGAAGAGGCTAGG + Intergenic
1186565833 X:10661471-10661493 AAATATACAAAAAATCAGCTGGG - Intronic
1186890577 X:13955568-13955590 ACTTCTCCAGAGAAGGAGCTGGG - Intergenic
1187011849 X:15287618-15287640 AAATAACCAGAAAACCGGCTGGG - Intronic
1187400653 X:18957061-18957083 AAAAATACAGAAAATTAGCTGGG - Intronic
1187643749 X:21323346-21323368 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1187893125 X:23955872-23955894 AAATATCAAAAAAATTAGCTGGG - Intergenic
1188156972 X:26752152-26752174 AAAAATCCAAAAAATTAGCTGGG + Intergenic
1188346402 X:29071878-29071900 ACATACCCAGAAATGGAACTGGG + Intronic
1188605338 X:32022154-32022176 AAAAATCCAGAAAAGGGGCCTGG + Intronic
1188745659 X:33839492-33839514 AAAAATGCAGAAAATTAGCTGGG - Intergenic
1188910831 X:35845422-35845444 AAATATACAAAAAATTAGCTAGG - Intergenic
1188951485 X:36380602-36380624 AAAAATACAAAAAAGTAGCTGGG - Intronic
1189078065 X:37939098-37939120 AAATACCCAAAAAACTAGCTGGG + Intronic
1189448695 X:41106688-41106710 AAAAATACAAAAAAGTAGCTGGG - Intronic
1189627591 X:42915766-42915788 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1189796399 X:44649940-44649962 AAATATACAAAAAATTAGCTGGG + Intergenic
1190068836 X:47262596-47262618 AAAAATACAGAAAATTAGCTGGG + Intergenic
1190235640 X:48613227-48613249 AAAAATACAAAAAAGTAGCTAGG - Intergenic
1190300061 X:49052289-49052311 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1190308040 X:49097485-49097507 AAAAATACAAAAAATGAGCTGGG - Intronic
1190819992 X:53964704-53964726 AAAAATACAAAAAAGTAGCTGGG + Intronic
1191858553 X:65647370-65647392 AAAAATCCAAAAAATTAGCTGGG - Intronic
1192008119 X:67239126-67239148 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1192063087 X:67851092-67851114 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1192400059 X:70826148-70826170 AAAAATACAAAAAAGTAGCTGGG + Intronic
1192435147 X:71138485-71138507 AAAAATCCAAAAAATTAGCTGGG - Intronic
1193474525 X:81946771-81946793 AAATATAGAAAAAAGTAGCTGGG - Intergenic
1193864941 X:86720096-86720118 AAAAATACAAAAAAGTAGCTGGG - Intronic
1193990448 X:88300235-88300257 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1194378367 X:93163964-93163986 AAAAATACAAAAAAGTAGCTGGG - Intergenic
1194960465 X:100229396-100229418 AAATAGCCAGAAGAGAAGGTTGG - Intergenic
1196882275 X:120209090-120209112 AAAAATACAGAAAATTAGCTGGG + Intergenic
1197001809 X:121448784-121448806 AAAAATCCAAAAAATTAGCTGGG - Intergenic
1198223740 X:134626437-134626459 AAATTTCCACAAAATGAACTAGG - Intronic
1198481263 X:137043489-137043511 ACATAGCTAGAAAAGGAGCTGGG + Intergenic
1198679962 X:139170759-139170781 ACATATCCAGAGAATTAGCTAGG - Intronic
1199080589 X:143572343-143572365 AAAAATACAAAAAATGAGCTGGG - Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1201164063 Y:11191711-11191733 AAAAATACAGAAAATTAGCTGGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201269741 Y:12243105-12243127 AAATACCAAGAAGAGGACCTGGG - Intergenic
1201277123 Y:12309636-12309658 AAAAATACAAAAAAGTAGCTGGG + Intergenic
1201482671 Y:14456839-14456861 AAACATACAGAAAATGAGCCGGG + Intergenic
1201731789 Y:17212366-17212388 AAACATACAAAAAAGTAGCTGGG + Intergenic
1201948551 Y:19538550-19538572 AAATATACAAAAAATTAGCTGGG + Intergenic