ID: 1059395274

View in Genome Browser
Species Human (GRCh38)
Location 9:114030508-114030530
Sequence GAGACACTGAAGCTGGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 505}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059395274_1059395280 15 Left 1059395274 9:114030508-114030530 CCGGTCTCCAGCTTCAGTGTCTC 0: 1
1: 0
2: 1
3: 57
4: 505
Right 1059395280 9:114030546-114030568 CAAGCTATGGGACAGGCCTCAGG No data
1059395274_1059395279 8 Left 1059395274 9:114030508-114030530 CCGGTCTCCAGCTTCAGTGTCTC 0: 1
1: 0
2: 1
3: 57
4: 505
Right 1059395279 9:114030539-114030561 CATTCAGCAAGCTATGGGACAGG No data
1059395274_1059395278 3 Left 1059395274 9:114030508-114030530 CCGGTCTCCAGCTTCAGTGTCTC 0: 1
1: 0
2: 1
3: 57
4: 505
Right 1059395278 9:114030534-114030556 GTAGGCATTCAGCAAGCTATGGG No data
1059395274_1059395277 2 Left 1059395274 9:114030508-114030530 CCGGTCTCCAGCTTCAGTGTCTC 0: 1
1: 0
2: 1
3: 57
4: 505
Right 1059395277 9:114030533-114030555 AGTAGGCATTCAGCAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059395274 Original CRISPR GAGACACTGAAGCTGGAGAC CGG (reversed) Intronic
900236167 1:1592136-1592158 GACACAGTGACGGTGGAGACAGG + Intergenic
900300437 1:1974209-1974231 GAGGCAAAGCAGCTGGAGACGGG + Intronic
900695638 1:4008134-4008156 GAGCCACTGGGGCTGGAAACAGG - Intergenic
901214238 1:7546058-7546080 GGGAGACTGAGGCAGGAGACTGG - Intronic
901465895 1:9420809-9420831 GGGAGACTGAGGCTGGAGAATGG + Intergenic
901789455 1:11646743-11646765 AGGAAACTGAAGATGGAGACAGG - Intergenic
901884701 1:12214901-12214923 AAGAAAATGAAGCTGGACACAGG + Intergenic
901898148 1:12332902-12332924 GAGACACTCAAGATGGAAAAAGG - Intronic
902925509 1:19693376-19693398 GGGACACTGAGGCAGGAGAATGG + Intronic
903022692 1:20405117-20405139 GAGAGCCAGAACCTGGAGACAGG + Intergenic
903788023 1:25874519-25874541 GAGAAACTAAGGCTGGAGAGGGG + Intergenic
904292532 1:29497301-29497323 GACACACTGTGGCTGGAGCCAGG - Intergenic
904727956 1:32564280-32564302 GAAACACTGAAGCTTGGCACTGG - Intronic
905030699 1:34882371-34882393 GAGAGGCTGAAGCAGGAGAATGG + Intronic
905365374 1:37448384-37448406 GGGACACTGACTCTGGAGGCTGG - Intergenic
905700798 1:40012173-40012195 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
906057913 1:42930567-42930589 GAGCCACTGAAGCTGTGGGCAGG + Intronic
907133174 1:52115456-52115478 CAGACTCTGAATCTGGAAACTGG - Intergenic
907972945 1:59402688-59402710 GGGACACTGAGCCTTGAGACAGG + Intronic
908041587 1:60119482-60119504 GCCACACTAAAACTGGAGACAGG + Intergenic
908608550 1:65828348-65828370 GAGAGACTGAGGCAGGAGAATGG - Intronic
909232208 1:73105302-73105324 GAGAAGCTGAAGCTGAAGGCAGG + Intergenic
909759004 1:79266192-79266214 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
910947287 1:92608044-92608066 GGGAGGCTGAAGCTGGAGAATGG + Intronic
912164846 1:107030868-107030890 GAGACACTGAAGGTACAGAATGG - Intergenic
912963073 1:114213332-114213354 AAGAAAATGAAGATGGAGACAGG + Intergenic
915273624 1:154773163-154773185 CAGACACTGAGGGTGGAGAGTGG - Intronic
915524349 1:156466929-156466951 GGGAATCTGAGGCTGGAGACAGG - Exonic
915816553 1:158973151-158973173 GAGTCACTGAGGCTGTAGGCTGG - Intronic
915915438 1:159937792-159937814 GAGACCCTCAATCTGGAGAGAGG + Exonic
915941637 1:160122025-160122047 GAGAGGCTGAAGCAGGAGAATGG + Intronic
915993479 1:160540861-160540883 GAGACTGAGAAGCTAGAGACAGG - Intergenic
917592308 1:176488864-176488886 GAGGCACTGAAGTGGGAGTCTGG + Intronic
917600220 1:176566350-176566372 CAGGCACTGAAGCTGGAGTGTGG - Intronic
918563510 1:185898096-185898118 TAGGCACTGAAGCTGGAAAGTGG + Intronic
919014055 1:192006293-192006315 GAGCCAGTGAAGATGGAGACAGG - Intergenic
919459042 1:197854915-197854937 AAGACACTGCAACTGGAGGCTGG + Intergenic
919937839 1:202266373-202266395 AAGACACTGATCCTGGAGAGAGG + Intronic
922234987 1:223715823-223715845 CAGTCACTGAACTTGGAGACAGG - Intronic
922363924 1:224846221-224846243 GAGACACTGCAGTAGGAGCCAGG + Intergenic
923595530 1:235358387-235358409 GGGAGGCTGAAGCTGGAGAATGG + Intergenic
923671347 1:236043691-236043713 GGGACGCTGAAGCAGGAGAATGG + Intronic
924384753 1:243490571-243490593 GAGAAACTGAGGCTGGAAAAAGG - Intronic
1063696837 10:8343894-8343916 GAGACAGGGAAGCTGGCGACGGG + Intergenic
1065231435 10:23602604-23602626 GAGATATTTAAGGTGGAGACAGG + Intergenic
1066226689 10:33390134-33390156 CAGGCACAGAATCTGGAGACAGG + Intergenic
1068665662 10:59672889-59672911 GAGACACAGAGACTGCAGACAGG + Exonic
1069178967 10:65332367-65332389 GATACACTGAAGCCAGACACAGG + Intergenic
1069239974 10:66127165-66127187 GAGAAGCTGAGGCAGGAGACTGG + Intronic
1069408105 10:68123579-68123601 GAGAGGCTGAGGCAGGAGACTGG + Intronic
1069468026 10:68659421-68659443 GAGAGGCTGAGGCTGGAGAATGG - Intronic
1069602235 10:69715381-69715403 GAGGGAGTGATGCTGGAGACTGG - Intergenic
1069809828 10:71150097-71150119 TAGACAATGCAGCTGAAGACAGG - Intergenic
1069955649 10:72049684-72049706 CAAACACAGAAGCTGGGGACAGG + Intergenic
1070193153 10:74131270-74131292 GAGAGACTGAGGCAGGAGAATGG - Intronic
1070593454 10:77816690-77816712 GTGACACTGAACCTGCAGAGAGG + Exonic
1070846842 10:79529962-79529984 GGGAGACTGAGGCAGGAGACAGG - Intergenic
1070926957 10:80230315-80230337 GGGAGACTGAGGCAGGAGACAGG + Intergenic
1071457478 10:85861937-85861959 GAGGATCTGAGGCTGGAGACAGG - Intronic
1071491521 10:86139637-86139659 GAGTCACTCCAGCTGGAAACAGG - Intronic
1072594682 10:96860361-96860383 CAGACACGGAAGATGGAGGCAGG + Intronic
1072694405 10:97592343-97592365 GAGAGACTGAGGCAGGAGAATGG - Intronic
1072828023 10:98628243-98628265 CAGACACTGAAGCTGGGTGCTGG + Intronic
1073220163 10:101865109-101865131 GAGAGACTGAGGCAGGAGAATGG + Intronic
1076739550 10:132476571-132476593 GACACAGTCCAGCTGGAGACAGG - Intergenic
1076934016 10:133555515-133555537 GAGAGACAGAAGGTGGAGAGAGG + Intronic
1077105592 11:841093-841115 GAGACACAGAAGCTTGGGAAAGG + Intronic
1077120790 11:907374-907396 GAGAGGCTGAAGCAGGAGAATGG + Intronic
1077539140 11:3138466-3138488 GAGGCAGTGCAGCTGGAGGCAGG + Intronic
1077940296 11:6833780-6833802 GAGCAACTGAAGCTGGAGAGTGG - Intergenic
1078060607 11:8040349-8040371 GACACTCTGCAGCTGGGGACAGG - Intronic
1078189309 11:9078379-9078401 GAGACACTGAAGTGGGATAAAGG + Intronic
1079965711 11:26977441-26977463 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
1081883181 11:46471471-46471493 GAGAGGCTGAAGCAGGAGAATGG + Intronic
1082771910 11:57214373-57214395 GAGTCACAGATGCTGCAGACTGG + Intergenic
1082880651 11:58034188-58034210 GGGAGACTGAAGCAGGAGAATGG - Intronic
1084162463 11:67357171-67357193 GGGACCCTGAAGGTTGAGACTGG + Intronic
1084433886 11:69126868-69126890 GAGACACTGAAGCTGCAACCAGG - Intergenic
1084543971 11:69804702-69804724 GGGACACTGAGGCTGGGGAGGGG + Intergenic
1084860976 11:72018067-72018089 GAGAGACTGAAGCATAAGACAGG + Intronic
1085329455 11:75635863-75635885 GAGATACTGAAGCACGAGAAAGG + Intronic
1085523397 11:77151061-77151083 GGGACAGGGAAGCTGGAGGCAGG - Intronic
1085914985 11:80875713-80875735 GAGACAATGAAGCAGTAGTCAGG - Intergenic
1086162330 11:83735901-83735923 CAGAGAGTGAATCTGGAGACTGG - Intronic
1086425500 11:86678544-86678566 GAGCTAGTGAAGCTGGTGACAGG - Intergenic
1087466227 11:98510067-98510089 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
1088550633 11:111009321-111009343 TGGACACTGCAGGTGGAGACGGG + Intergenic
1089213508 11:116821750-116821772 GAGAAACTGAAGGAGGAGATTGG - Exonic
1089419335 11:118319425-118319447 GAGACACTGGAGCAGAAGAAAGG - Intergenic
1089561122 11:119343712-119343734 AAGAAAATGAAGCTGGAGAATGG + Intronic
1089578259 11:119461980-119462002 GTGCCACTGAAGCTGGGGAGTGG - Intergenic
1089596452 11:119584016-119584038 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1089720332 11:120412673-120412695 GGGACACTTAGACTGGAGACTGG - Intronic
1090257425 11:125295057-125295079 CAGACAGTGAAGCTAGAGGCGGG + Intronic
1090613888 11:128497217-128497239 GAGATACTGTAACTTGAGACTGG - Intronic
1091529855 12:1343944-1343966 GGGACACTGAGGCAGGAGAATGG - Intronic
1091565401 12:1644413-1644435 GAGAAACTGAAGCTCTAGAGAGG - Intronic
1091642732 12:2249911-2249933 GAGAGACTGAGGCAGGAGAATGG - Intronic
1091814961 12:3430833-3430855 GAAACACAGAAGCTAAAGACAGG + Intronic
1092210874 12:6645763-6645785 GAGAGACTGAGGCAGGAGAATGG - Intronic
1093421340 12:18978015-18978037 GAGAGGCTGAAGCAGGAGAATGG + Intergenic
1093648148 12:21612329-21612351 GAGAGACTGAGGCGGGAGAATGG + Intergenic
1095043147 12:37466648-37466670 GAGACGCTGAGGCAGGAGAATGG + Intergenic
1096270840 12:50165312-50165334 GGGAGACTGAAGCAGGAGAATGG + Intronic
1096302064 12:50438390-50438412 GAGAGGCTGAGGCTGGAGAATGG + Intronic
1096324500 12:50647302-50647324 GTGACACAGAAGAGGGAGACGGG + Intronic
1096500782 12:52062864-52062886 GAGAGCCTGAAGCTGGAGCAGGG - Intergenic
1096554544 12:52395319-52395341 GAGACGCGGAGGCTGGAGGCTGG - Intronic
1097697321 12:62787191-62787213 CAGCAACTTAAGCTGGAGACAGG + Intronic
1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG + Exonic
1097946490 12:65374952-65374974 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1098385688 12:69916298-69916320 GAGAGAAGAAAGCTGGAGACGGG + Intronic
1099516323 12:83600663-83600685 GAGAGACTGAGGCAGGAGAATGG - Intergenic
1100000624 12:89830622-89830644 GAGACACTGTAGTTGCACACAGG + Intergenic
1100735403 12:97523969-97523991 GGGAGACTGAAGCGGGAGAATGG + Intergenic
1102115125 12:110397097-110397119 GGGAGGCTGAAGCAGGAGACTGG + Intronic
1102646074 12:114404875-114404897 GAGACATTGAATCTGCAGCCCGG + Intronic
1102905722 12:116673877-116673899 GAACCAGTGAAGCAGGAGACGGG - Intergenic
1103749576 12:123150235-123150257 GGGGCACTGAGGATGGAGACGGG + Intergenic
1104043835 12:125147586-125147608 GTGACACTGAAGCTGTAGCCTGG + Intergenic
1104412279 12:128569073-128569095 GAGATACTGAAGCAGGTGAGCGG + Intronic
1104555672 12:129797813-129797835 GTGTAAATGAAGCTGGAGACAGG + Intronic
1105276644 13:18934853-18934875 GAGACATTGGAGCTGAAGAAAGG - Intergenic
1105686851 13:22792668-22792690 GAAAAGCTGAAGCTGGAGACAGG + Intergenic
1105866970 13:24469665-24469687 AAGACACTGAAGATGAAGACTGG + Intronic
1105887282 13:24652703-24652725 GAGACACAGAAGTGGGAGAGTGG - Intergenic
1106143652 13:27033258-27033280 GAGGGACTGAGGCAGGAGACTGG + Intergenic
1106335323 13:28778208-28778230 AAGACACTGTTGCTGGAGAGTGG + Intergenic
1106391511 13:29339267-29339289 AAGACACTGCTGCTGGAGAGTGG + Intronic
1107830059 13:44367134-44367156 GAGCCACTGAAGTGGCAGACAGG - Intergenic
1108180163 13:47832741-47832763 AGGACACTGATGTTGGAGACAGG + Intergenic
1108252086 13:48577570-48577592 AAGACACTCAAGCAGAAGACAGG + Intergenic
1109830875 13:67786072-67786094 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1110628703 13:77680449-77680471 GAGACACAGAACTTGAAGACAGG + Intergenic
1111314700 13:86538524-86538546 GAGACTCAGAAGCGGGAGAATGG + Intergenic
1112195143 13:97218303-97218325 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1112411707 13:99170083-99170105 GAGAGCCTGAAGCAGGAGAACGG - Intergenic
1112520132 13:100088036-100088058 GAGAAACTGAAGCTGTAGCAGGG - Intergenic
1114402213 14:22420434-22420456 GAGACAGTGCAGGCGGAGACTGG + Intergenic
1114920658 14:27323973-27323995 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1115770247 14:36659450-36659472 GAGAAGCCGAAGCTGCAGACAGG - Intronic
1116185460 14:41595431-41595453 GAGACTCTGAATTTGCAGACTGG + Intergenic
1116906079 14:50405010-50405032 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1117159788 14:52977616-52977638 AAGACTCTGGAGTTGGAGACTGG - Intergenic
1117353204 14:54901301-54901323 GACACACGGAAGGTGTAGACTGG + Intronic
1117539383 14:56731921-56731943 GTGACACAGAAGCTAGAGCCAGG - Intergenic
1117699824 14:58401463-58401485 GGGAGACTGAAGCAGGAGAATGG + Intronic
1119445766 14:74662105-74662127 GAGACCCTGATGCTGGATCCCGG + Exonic
1119562998 14:75605810-75605832 GGGACACAGAAGCTGGAGCAAGG + Intronic
1121229271 14:92344680-92344702 GAGACAGTGAAAGTGGAGAGAGG + Intronic
1121568054 14:94925470-94925492 GGGACACAGCAGCAGGAGACAGG - Intergenic
1121678331 14:95772412-95772434 GAGAGACTGAGGCAGGAGAATGG - Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1202904187 14_GL000194v1_random:59175-59197 GGGACACAGAGGCTGGAGACGGG - Intergenic
1123475414 15:20588450-20588472 GGGACACTGAGGCAGGAGAATGG - Intergenic
1123642597 15:22411913-22411935 GGGACACTGAGGCAGGAGAATGG + Intergenic
1123690955 15:22838161-22838183 GGGACACTGAGGCAGGAGAAGGG - Intergenic
1123954872 15:25324732-25324754 AATACACTGAAGCTGTAGAAAGG + Intergenic
1125102719 15:35933563-35933585 GAGAAACTGAAGCAGATGACAGG + Intergenic
1125450643 15:39803382-39803404 GAGAGACTGAGGCAGGAGAATGG - Intronic
1125500603 15:40238514-40238536 GAGACACTGAGGCTAGGGATGGG + Intergenic
1125793428 15:42386924-42386946 GAGCCTTTGAAGCTGGAGACAGG - Intronic
1126405713 15:48320618-48320640 GAGACTAAGAAGCTGGAGGCTGG - Intergenic
1127106959 15:55626651-55626673 GAGAGACTGAGGCAGGAGAATGG + Intronic
1128144082 15:65322681-65322703 GGGACACTGGGGCTGGACACAGG - Intergenic
1128228458 15:66018819-66018841 GAGAGACTGACCCTGGAGAGAGG + Intronic
1128750204 15:70143415-70143437 GAGACGCTGAGGCAGGAGAATGG - Intergenic
1128923611 15:71634080-71634102 GGGACACTGAGGCAGGAGAATGG + Intronic
1129598004 15:76979961-76979983 GACAAGCTGAAGCTGGAGGCAGG - Intergenic
1131363680 15:91818708-91818730 AAGACATTGAAGCTGGAGTATGG + Intergenic
1131964786 15:97830425-97830447 GGGACACTGAGGCAGGAGAATGG + Intergenic
1132405025 15:101536718-101536740 CAGACAATGAAGCTGGGGCCCGG - Intergenic
1133094216 16:3430137-3430159 GAGAAAGTGTAGCTGGAGAGGGG + Intronic
1134090322 16:11388137-11388159 GAGGCCCTGCAGCTGGAGGCAGG + Intronic
1134386077 16:13773875-13773897 GATCCACTGAAGCTGGGGAAAGG + Intergenic
1134490981 16:14694982-14695004 GAGACACTGAGGCTGGGCACAGG + Intergenic
1134496362 16:14734100-14734122 GAGACACTGAGGCTGGGCACAGG + Intronic
1134803972 16:17108993-17109015 GAGGCACTGAAGCTGCACAATGG - Exonic
1135769198 16:25203654-25203676 GGGAGGCTGAAGCAGGAGACTGG - Intergenic
1136143916 16:28304348-28304370 AAGACACTGGAGCTGGAGAGAGG + Intronic
1136487235 16:30581353-30581375 GGGAGACTGAAGCAGGAGAATGG + Exonic
1137442298 16:48507763-48507785 ATGACACTAAGGCTGGAGACTGG + Intergenic
1137766564 16:50981945-50981967 TATAGACTGAAGATGGAGACTGG - Intergenic
1138593515 16:58016578-58016600 AGGACACTGAACCGGGAGACAGG + Intronic
1139256426 16:65547232-65547254 GATACACTGAGGATGGAGAAAGG + Intergenic
1139973039 16:70787958-70787980 GAGCCACTGAAGGTGGAAAAAGG + Intronic
1141083973 16:81078001-81078023 GGGAAACTGAGGCAGGAGACTGG + Intergenic
1141424359 16:83935670-83935692 GAGCCACTGAAGCAAGAGAGCGG + Intronic
1141473697 16:84257505-84257527 GAGACAGTGAAGCTGCACACGGG - Intergenic
1141651640 16:85396090-85396112 GACAGACTGAGGCTGGAAACAGG - Intergenic
1142302078 16:89264804-89264826 GAAATACTGAAGCTAGAGAGAGG - Intergenic
1144643512 17:16952773-16952795 GGGAAACTGAGGCTGGAGAGGGG - Intronic
1144678444 17:17176718-17176740 TACACACTGAAGCTGGAGCCAGG - Intronic
1145176823 17:20707788-20707810 GGGAGACTGAGGCTGGAGAACGG - Intergenic
1145205239 17:20981303-20981325 GGGAAACTGAGGCTGGAGAGGGG + Intergenic
1145241846 17:21244749-21244771 GAGAAACTGACGCTGGGCACAGG + Intronic
1145929963 17:28678359-28678381 GAGAAAATAAAGCTGCAGACAGG - Intronic
1146326367 17:31889599-31889621 GGGAGACTGAAGCAGGAGAATGG - Intronic
1146357488 17:32146548-32146570 GGGAGACTGAGGCAGGAGACTGG - Intronic
1146476588 17:33167506-33167528 GAGACACAAAAACTGGAGAAGGG - Intronic
1146724011 17:35142780-35142802 GGGACACTGAGGCTGGGGAGTGG - Intergenic
1146824419 17:36010450-36010472 GAGAGACTGAAGCTGGATAGGGG - Intergenic
1147647760 17:42043883-42043905 GGGAAACTGAGTCTGGAGACAGG + Intronic
1147932419 17:43990896-43990918 GAGATACTGAGGCAGGAGAATGG - Intronic
1148358018 17:46989208-46989230 CAGACCCTGAAGCAGGTGACAGG - Intronic
1148494719 17:48046657-48046679 GAGACAATGAAGATAAAGACTGG - Intergenic
1148649823 17:49242154-49242176 GAGACAGTTATGCAGGAGACCGG + Intergenic
1149990861 17:61382905-61382927 GAGGCACTGAAGCCTGAAACAGG + Intronic
1150048342 17:61935132-61935154 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
1150253628 17:63725454-63725476 GGGAGACTGAAGCAGGAGAATGG - Intronic
1151965690 17:77430101-77430123 GAGACAGTGGTTCTGGAGACAGG + Intronic
1152438696 17:80291964-80291986 GTGTCACTGAACCTGGAGGCTGG - Intronic
1152619438 17:81354689-81354711 GAAACACTGAAACTGGAAAGAGG + Intergenic
1154202012 18:12306731-12306753 GAGAGACTAAAGCTGGAGGAAGG + Intergenic
1154220463 18:12448965-12448987 GAGACACTGAACCAGGGCACTGG + Exonic
1155337502 18:24779821-24779843 TTGACAATGAAGATGGAGACGGG - Intergenic
1155458464 18:26047736-26047758 GGGACACTGAGGCAGGAGAATGG + Intronic
1155993898 18:32309509-32309531 GGGAGACTGAAGCAGGAGAATGG + Intronic
1156018781 18:32576256-32576278 GAGAAACTGAACATGGAGACAGG - Intergenic
1156192916 18:34740452-34740474 CAGACACTGAAGCTGGAATCTGG + Intronic
1156812808 18:41273259-41273281 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1157256364 18:46143268-46143290 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1157731435 18:50007580-50007602 CATGCACTGAAGCTGGAGAGAGG - Intronic
1158069920 18:53458967-53458989 CAGCCGCTGAAGCTGGAGAAAGG + Intronic
1158492217 18:57920586-57920608 AAGACTCAGAAGCTGGAGAATGG - Intergenic
1158751043 18:60261413-60261435 GAGGCACTGAATCTAGAGATGGG + Intergenic
1159330842 18:66992078-66992100 GGGAGACTGAGGCTGGAGAATGG + Intergenic
1160100288 18:75914555-75914577 GTGACAACGGAGCTGGAGACTGG - Intergenic
1160552400 18:79702994-79703016 GAGACCCTGAGGCTGGTGCCTGG + Intronic
1160729421 19:634200-634222 GGTAAACTGAAGCTGGAGGCTGG - Intergenic
1160917436 19:1503937-1503959 GGGAAACTGAGGCTGGAGAGGGG + Intergenic
1160953786 19:1680170-1680192 CGGACACTGGAGCTGGAGGCTGG + Intergenic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1161651469 19:5488284-5488306 GGGAGGCTGAAGCTGGAGAATGG - Intergenic
1161882715 19:6967991-6968013 GAGAGATTGAAGCAGGAGAAAGG - Intergenic
1162805567 19:13136384-13136406 GAGAAGCTGGAGCTGGTGACAGG + Exonic
1163011672 19:14430522-14430544 GAGAGACTGAGGCAGGAGAATGG - Intergenic
1163139064 19:15333699-15333721 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1163694721 19:18758253-18758275 GAGACACTGAGGCAGGAGAATGG + Intronic
1163826893 19:19529000-19529022 GGGAGAGGGAAGCTGGAGACGGG + Intronic
1163893071 19:20033848-20033870 TAGAAACTGAGGCTGGAGGCCGG - Intronic
1164198885 19:23000271-23000293 GGGAGACTGAAGCAGGAGAATGG + Intronic
1164422895 19:28112787-28112809 GAGACTCAGAAGCAGGAGATTGG + Intergenic
1164938305 19:32231732-32231754 GAAACAGTGAAACTGGAGACTGG + Intergenic
1165802161 19:38559336-38559358 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1166170852 19:41026921-41026943 GGGACAGGGATGCTGGAGACAGG + Intergenic
1166253980 19:41589472-41589494 GAGACATTGAAGGTGAGGACAGG - Intronic
1166791867 19:45403536-45403558 GAGAAACGGAGGCTGGAGAGTGG - Intronic
1166941689 19:46370843-46370865 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1167032310 19:46971068-46971090 GAGACACTGGAAATGGAGCCAGG - Intronic
1167394369 19:49218412-49218434 GGGAGACTGAGGCTGGAGAATGG - Intergenic
1167559617 19:50217962-50217984 GAGACAATGAACATGGAGACAGG - Intronic
1167988588 19:53338993-53339015 GGGAAACTGAAGCAGGAGAATGG + Intronic
1168249893 19:55135914-55135936 GGGACACTGAGTGTGGAGACGGG - Intronic
1168714884 19:58520945-58520967 GGGAGACTGAGGCAGGAGACTGG + Intronic
925224197 2:2168620-2168642 GGGGCACTGAAGGTGGAGAGTGG - Intronic
926318496 2:11730218-11730240 GAATCACTGAAGCTGGAGGTAGG - Intronic
926637026 2:15191868-15191890 GGGACCCTGAGGCTGGAGACAGG - Intronic
926666931 2:15535415-15535437 GAGACACTGAGGCAGGAGAATGG + Intronic
927230705 2:20822227-20822249 GGGAGACTGAAGCAGGAGAATGG - Intronic
927505967 2:23615111-23615133 AAGACACTGAACCTGGTGCCTGG + Intronic
929217679 2:39433353-39433375 GAGATAGTAAAGCTGGAGATGGG - Intronic
929829089 2:45333128-45333150 GAAACTCAGAAGCTAGAGACAGG - Intergenic
930200299 2:48546313-48546335 GAGACAGCCAAGCTGGAGCCAGG - Intronic
931089020 2:58865802-58865824 GAGAGAATGAAGCAGCAGACAGG - Intergenic
931200389 2:60092170-60092192 GAAACAATAAAGCTGGAGACAGG + Intergenic
932327752 2:70874339-70874361 GAGACATTGAAGCTGGAGTTAGG - Intergenic
932490743 2:72118599-72118621 GAGAAACCGAAGTGGGAGACTGG + Intergenic
932541909 2:72664308-72664330 AAGACACTGAGGCTGAAGAGTGG + Intronic
932719323 2:74126604-74126626 GGGACACTGAGGCAGGAGAATGG - Intergenic
933132186 2:78685444-78685466 GAGACTCAGAAGCGGGAGAATGG + Intergenic
933666906 2:84971398-84971420 GGGACACTGCAGCCGGAGCCCGG + Exonic
934126034 2:88891253-88891275 GAGAGGCTGAAGCAGGAGAATGG + Intergenic
934140300 2:89040472-89040494 CAGACACGGAAGATGGAGACTGG + Intergenic
934146526 2:89100107-89100129 CAGACAGTGAGGATGGAGACTGG + Intergenic
934222742 2:90100468-90100490 CAGACAGTGAGGATGGAGACTGG - Intergenic
934228935 2:90160065-90160087 CAGACACGGAAGATGGAGACTGG - Intergenic
934502452 2:94871223-94871245 GGGACTCAGAGGCTGGAGACGGG + Intergenic
935751292 2:106236114-106236136 GGGAGACTGAGGCTGGAGAATGG + Intergenic
936547675 2:113406600-113406622 CAGACAGGGAAGATGGAGACTGG - Intergenic
937356249 2:121199892-121199914 GAGAACCTGGAGCTGGGGACAGG + Intergenic
937565153 2:123276599-123276621 GAGAAACAGAAGCAGGAAACTGG + Intergenic
937685339 2:124690352-124690374 GAAACACTGCTTCTGGAGACTGG - Intronic
937880529 2:126861144-126861166 GAGAAACTGTAGCTCTAGACTGG - Intergenic
938668555 2:133564954-133564976 GAGACACAGAGGCTGAAGAGGGG + Intronic
938908293 2:135860235-135860257 GAGAGGCTGAAGCAGGAGAATGG - Intronic
939647468 2:144718141-144718163 GACACACTGAAGTTGAAGAAGGG + Intergenic
940102816 2:150061721-150061743 GAGAGACTGAGGCAGGAGAATGG - Intergenic
941157018 2:161991622-161991644 GGGACACTGAGGCAGGAGAATGG - Intergenic
943083774 2:183287784-183287806 GAGAGACTGAGGCAGGAGAATGG - Intergenic
943181963 2:184555898-184555920 GAGAGACTGAGGCAGGAGAATGG + Intergenic
945786102 2:214239706-214239728 GCTGCACTGGAGCTGGAGACAGG + Intronic
946878055 2:224150105-224150127 GGGACACTGAGGCAGGAGAATGG - Intergenic
947119321 2:226799483-226799505 CAGCCACTGCAGCTGGGGACCGG + Exonic
948448099 2:238049327-238049349 GAGAGACTGAGGCAGGAGAATGG + Intronic
948877916 2:240839988-240840010 GGGAAACTGAGGCTGGAGAGAGG - Intergenic
1169136585 20:3201352-3201374 GGGACGCTGAAGCAGGAGAATGG + Intronic
1169416577 20:5422348-5422370 GAGACTCAGAAGCTGGAGGGTGG + Intergenic
1169817915 20:9678049-9678071 TAGAAACTGAGGCTAGAGACAGG - Intronic
1170698918 20:18685542-18685564 GAGCCACTGAAGCTGGAGCGAGG - Intronic
1173386583 20:42593942-42593964 GAGAGGTTGAAGCTGGAGACAGG + Intronic
1173630147 20:44506985-44507007 AAGACAGTAAAGCTGGAGAAAGG + Exonic
1173943939 20:46935042-46935064 GAGACGCTGAGTCTGGAGGCAGG + Intronic
1174615870 20:51834939-51834961 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1174647666 20:52100096-52100118 GGGAGACTGAAGCAGGAGAATGG - Intronic
1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG + Intergenic
1175331702 20:58169024-58169046 GAGACATTGAAGCATGAGAGGGG + Intergenic
1176623554 21:9073942-9073964 GGGACACAGAGGCTGGAGACGGG - Intergenic
1176697187 21:9992318-9992340 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1177058137 21:16335201-16335223 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
1177815218 21:25969241-25969263 GAGAGGCTGAGGCTGGAGAATGG + Intronic
1178923526 21:36756344-36756366 GAGAGACTGAGGCAGGAGAATGG + Intronic
1178989502 21:37341016-37341038 GAGAGACTGAGGCTGGAGGATGG + Intergenic
1179473909 21:41631308-41631330 GAGCCACTGAAGCTGGAGAAAGG - Intergenic
1179791640 21:43759332-43759354 GAGAGAATGAGGCTGGAGCCAGG - Exonic
1179900351 21:44389975-44389997 GGGAGGCTGAAGCTGGAGAATGG - Intronic
1181110011 22:20596761-20596783 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1181938245 22:26454201-26454223 GAGACACTGAAGCTTGGAATAGG - Intronic
1181957731 22:26600295-26600317 GGGAGACTGAAGCAGGAGAACGG + Intronic
1183152132 22:36046177-36046199 GAGACATCCAAGGTGGAGACTGG - Intergenic
1183185333 22:36288566-36288588 GAGTCACTGAACCCCGAGACAGG + Intronic
1183450426 22:37891523-37891545 GAGACACTGAGGAAAGAGACAGG + Intergenic
1183963213 22:41425249-41425271 GGGACACTGAGGCAGGAGAATGG + Intergenic
1184285422 22:43468386-43468408 CAAACCCTGAAACTGGAGACAGG - Intronic
1184469616 22:44688881-44688903 GGGAGGCTGAAGCAGGAGACTGG + Intronic
1185220645 22:49627615-49627637 GAGACAGGGCAGCTGGAGACAGG + Intronic
949538873 3:5016808-5016830 CAGACACGGGAGCTGGAGAGTGG + Intergenic
950027009 3:9827023-9827045 GAGATGCTGAAGCTGGTGAACGG + Exonic
950151088 3:10688133-10688155 GAGAAACTGAAGCTAGAGGCAGG - Intronic
950334767 3:12184763-12184785 GAGGCACTGAAGCTGAGGCCTGG - Intronic
950721850 3:14888797-14888819 AAGACACAGAGGCTGGAGAAGGG + Intronic
951768824 3:26231851-26231873 GAGAAAATGAAGCTGGGGAGAGG - Intergenic
953427477 3:42806842-42806864 GAGAGACTGAGGCAGGAGAATGG + Intronic
953566423 3:44035784-44035806 AAGACACAAAAGCTGGATACTGG - Intergenic
954234686 3:49247332-49247354 GAGAGACTCATGCAGGAGACTGG - Intronic
956126267 3:66013654-66013676 GGGAGACTGAAGCAGGAGAATGG + Intronic
956271718 3:67454855-67454877 GAGAGACTGAGGCAGGAGAATGG + Intronic
957138993 3:76328752-76328774 GGGAGGCTGAAGCAGGAGACTGG + Intronic
957612029 3:82480563-82480585 GAGAGACTGAGGCAGGAGAATGG - Intergenic
957801288 3:85086366-85086388 GAAAGACTGAAGTGGGAGACAGG - Intronic
958072496 3:88632299-88632321 AAGACACTGAAGCTGTAGCAGGG - Intergenic
960621216 3:119638540-119638562 GAGACGCTGACGCGGGAGAATGG + Intronic
961044530 3:123699605-123699627 GGGACACAGAGGCTGGAGCCAGG - Intronic
961394273 3:126576131-126576153 GAGAGGCTGAAGCAGGAGAATGG - Intronic
961954550 3:130788077-130788099 GACAGGCTGAAGCTGGATACTGG - Intergenic
962538247 3:136350717-136350739 AAGAAACTGCAGCTGGAGAGAGG + Intronic
963899267 3:150718503-150718525 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
964153517 3:153557757-153557779 GGGACACTGAGGCAGGAGAATGG - Intergenic
964169160 3:153747459-153747481 CAGAAACCGAAGCTGGTGACTGG + Intergenic
964450642 3:156809548-156809570 AAGAAAATGAAGCTGGGGACAGG - Intergenic
965264009 3:166517874-166517896 GTGAGACTGAAGCAGGAGAACGG + Intergenic
965670534 3:171143226-171143248 GAGACACAGCAGCTGGAAATTGG - Intronic
965755826 3:172026173-172026195 GGGACACTGAGGCAGGAGAATGG - Intergenic
966357194 3:179093593-179093615 GAGAAACTGAAGCATGAGAGAGG - Intergenic
966833728 3:184032993-184033015 GCGACACTGTAGTTGGTGACTGG - Exonic
967080780 3:186047707-186047729 AAGACACTGCAGCTTGAGAGGGG - Exonic
968045683 3:195622746-195622768 GAGGATATGAAGCTGGAGACTGG - Intergenic
968064396 3:195750511-195750533 GAGGATATGAAGCTGGAGACTGG - Intronic
968151234 3:196338292-196338314 GAGAGACAGAACCTGGAGAAAGG + Exonic
968183368 3:196613745-196613767 GAGAGACTGAGGCAGGAGAATGG + Intergenic
968308973 3:197667341-197667363 GAGGATATGAAGCTGGAGACTGG + Intergenic
971011172 4:22437389-22437411 GAAACACTGAGGTTAGAGACAGG + Intronic
972120803 4:35699947-35699969 GAGAGGCTGAGGCAGGAGACTGG - Intergenic
972361495 4:38329560-38329582 CAGACACTCAAGCTGGATAACGG - Intergenic
972628612 4:40824281-40824303 GAGACAGTGAGGGTGGAGAGAGG - Intronic
973188625 4:47361402-47361424 GAGAAACTAAAGCTGAAGCCAGG + Intronic
974093110 4:57333230-57333252 GAGACAGGGAAGCTGGAACCAGG - Intergenic
974452663 4:62086824-62086846 AAGACTCAGAAGCTGGAGACTGG - Intergenic
974624978 4:64414050-64414072 AAGACACTGAACCTGGGGATGGG + Intergenic
974694341 4:65345875-65345897 GAGAGGCTGAAGCAGGAGAATGG - Intronic
976470703 4:85425361-85425383 GGGACACTGAGGCAGGAGAATGG - Intergenic
977314286 4:95425424-95425446 GCGACGCTGAAGCAGGAGAATGG - Intronic
978033133 4:103960304-103960326 GGGAGACTGAAGCAGGAGAATGG + Intergenic
978342627 4:107734450-107734472 GAGACACTGAGCCTGGAGCAGGG + Intergenic
978428398 4:108606025-108606047 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
978795283 4:112702502-112702524 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
979362559 4:119782483-119782505 GGGAGACTGAGGCAGGAGACTGG - Intergenic
979990497 4:127369347-127369369 GGGAGACTGAGGCGGGAGACTGG - Intergenic
981675938 4:147342766-147342788 GAGACGCTGAGGCAGGAGAATGG + Intergenic
982235578 4:153248851-153248873 GTGACACTGAAGTAGGAGCCTGG - Intronic
982737095 4:159018148-159018170 GTGACACTGAAGGAGGAGGCAGG + Intronic
983574549 4:169247147-169247169 CAGACACTGAAACTGGAGATGGG + Intronic
986314102 5:6574627-6574649 AAGCCACTGCAGCTGGAGACAGG + Intergenic
986861118 5:11927689-11927711 GAGCCATTGAAGCTGGGGAAGGG + Intergenic
987884704 5:23799076-23799098 GAGAGACTGAGGCAGGAGAATGG - Intergenic
988246348 5:28687521-28687543 GGGAGACTGAGGCAGGAGACTGG + Intergenic
989753045 5:44918896-44918918 GAGAGGCTGAAGCAGGAGAATGG + Intergenic
990215911 5:53531463-53531485 GAGAGACTGAGGCAGGAGAATGG + Intergenic
990654107 5:57935543-57935565 GAGAGACTGAGGCAGGAGAATGG - Intergenic
991968999 5:72120527-72120549 GGGAGACTGAAGCAGGAGAATGG - Intronic
992145214 5:73840217-73840239 CAGAGACTGAAGCAGGAGAATGG - Intronic
992397607 5:76382105-76382127 GGCAGACTGAAGCTGGAGGCAGG - Intergenic
992609023 5:78491373-78491395 GAGCAAGTGAAGCTGGAGAGAGG + Intronic
992850210 5:80799235-80799257 GGGAAAATGAAGCTGGAGAGCGG - Intronic
993161894 5:84302399-84302421 GAGAGACTGAGGCAGGAGAATGG - Intronic
993744764 5:91583411-91583433 GGGACACTGAGGCAGGAGAATGG + Intergenic
994624144 5:102196656-102196678 GTGACACTGCAGCTGGACACGGG - Intergenic
995855209 5:116584518-116584540 GAGACACTGACGCTGGATCAAGG - Intergenic
996039334 5:118792887-118792909 GTGAGACTGAACCTGAAGACAGG - Intergenic
996515587 5:124365871-124365893 CATGCACTGAGGCTGGAGACAGG - Intergenic
997028782 5:130097899-130097921 GGGAGACTGAGGCAGGAGACTGG + Intronic
997182546 5:131845163-131845185 CAGACACTGAGGCAGGAGAATGG + Intronic
997263490 5:132481185-132481207 CAGACACTGAAGAGGGAGACAGG + Intergenic
997303648 5:132823795-132823817 GAGCCCCTGAAGTTGGGGACAGG - Intronic
997594574 5:135097762-135097784 TAGACACTGAAGCTTCAGAAGGG + Intronic
997839189 5:137223149-137223171 AAGAGACTGAGGATGGAGACAGG + Intronic
998168031 5:139855645-139855667 CAGTCACTCAAGCTGGGGACAGG - Intronic
998272581 5:140720114-140720136 GAGAGGCTGAAGCAGGAGAATGG + Intergenic
998465600 5:142341433-142341455 GAGAAACTGAAGGAGGAGAAAGG + Intergenic
998790731 5:145763969-145763991 GGGAGACTGAAGCAGGAGAATGG + Intronic
998906092 5:146906952-146906974 GTTACACTGTAGCAGGAGACAGG + Intronic
1000019403 5:157306135-157306157 GAGACACTGAAGGAGAAGAAAGG - Intronic
1000158202 5:158572960-158572982 GAGACACTGAGGCTGAGGTCAGG + Intergenic
1000235745 5:159358640-159358662 GAGAAACAGAAGATGGAAACAGG - Intergenic
1000470479 5:161633723-161633745 GGGACACTGAGGCAGGAGAATGG + Intronic
1001348885 5:170936344-170936366 GAGAGACTGACGCAGAAGACAGG - Intronic
1001538844 5:172522862-172522884 GAGACGCTGAGGCAGGAGAATGG - Intergenic
1002052585 5:176579708-176579730 GAGGAGCTGAAGGTGGAGACTGG + Intronic
1002627797 5:180543913-180543935 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1002793080 6:449573-449595 GGGAAGCTGAGGCTGGAGACGGG + Intergenic
1002949331 6:1793567-1793589 GAGCCACCGCAGGTGGAGACTGG + Intronic
1002992044 6:2246774-2246796 GAGACCCTGAAGCTGAGGAGAGG + Intergenic
1003355412 6:5364935-5364957 GAGCCACTGGAGCCTGAGACAGG + Intronic
1003486320 6:6582800-6582822 GACACACTGAAGCCAGAGCCTGG + Intergenic
1003577037 6:7306809-7306831 GGGAGACTGAGGCAGGAGACTGG + Intronic
1003648582 6:7937375-7937397 GTGTCACTGAGGCTGGAGTCTGG + Intronic
1004078598 6:12368712-12368734 GAGACAATGAGGCAGGAGAGAGG + Intergenic
1004325184 6:14668322-14668344 GAGAGAAAGAATCTGGAGACAGG - Intergenic
1004427909 6:15518584-15518606 CAGAAACTGAAGCAGGAGAATGG - Intronic
1006478872 6:34275694-34275716 GAGAAACTGAAGGTGGGGAGGGG - Intergenic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007481538 6:42153603-42153625 AAGACACTGAGCCTGGAGAGGGG + Intergenic
1010533607 6:76995845-76995867 GAGACGCTGAGGCAGGAGAATGG + Intergenic
1011777100 6:90743058-90743080 GGGAGGCTGAAGCTGGAGAATGG + Intergenic
1012658069 6:101850998-101851020 GACACAGTGTAGCTGGAGATAGG + Intronic
1013115221 6:107098396-107098418 GAGAAACTGAAGCCAGAGATGGG + Intronic
1014388105 6:120825923-120825945 GAGAGGCTGAAGCAGGAGAATGG + Intergenic
1014908824 6:127064392-127064414 GGGACACTGAGGCAGGAGAATGG - Intergenic
1015418619 6:132980651-132980673 GTGACACTGTAGGTGGACACTGG - Intergenic
1016052012 6:139539476-139539498 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1016223051 6:141699312-141699334 GAGACTCTGAAGGAGGAGAGTGG + Intergenic
1016347908 6:143135553-143135575 AAGTCACTGAAGCTAAAGACAGG + Intronic
1017448048 6:154527047-154527069 GAGAAACTGGACATGGAGACAGG + Intergenic
1017814011 6:158003918-158003940 GGACCACTGGAGCTGGAGACGGG + Intronic
1017832758 6:158146511-158146533 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1018117246 6:160599236-160599258 GAGAGGCTGAAGCAGGAGAATGG + Intronic
1018362730 6:163087824-163087846 GAGGCAGTGAGGATGGAGACTGG + Intronic
1018475303 6:164134737-164134759 GAGTCACTGAAGCGGGAGCCAGG + Intergenic
1020049187 7:5070801-5070823 GGGAGACTGAAGCAGGAGAATGG - Intronic
1020051152 7:5082637-5082659 GAGACACTGAGGCAGGAGAATGG + Intergenic
1022403689 7:30065947-30065969 CAGACACTGAGGCTGGGGCCTGG + Intronic
1025029231 7:55543018-55543040 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1025064661 7:55842806-55842828 GGGAGGCTGAAGCTGGAGAATGG + Intronic
1025120172 7:56295173-56295195 GAGAGCCTGAAGCAGGAGAATGG - Intergenic
1026017853 7:66684737-66684759 GGGAGACTGAAGCAGGAGAATGG - Intronic
1026262857 7:68770931-68770953 GAGACACTGCTGCTGCAGCCTGG - Intergenic
1026914136 7:74109738-74109760 GGGAGACTGAAGCAGGAGAATGG + Intronic
1026945462 7:74313273-74313295 GAGCCACTCCAGCTGGAGGCTGG - Intronic
1026964928 7:74433558-74433580 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
1027719453 7:81721140-81721162 GAGAGGCTGAAGCAGGAGAATGG + Intronic
1028984908 7:97002134-97002156 GAGACAAAGAAGCAGGAGCCAGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031468264 7:122140378-122140400 GGGAGACTGAGGCTGGAGAATGG + Intronic
1031870878 7:127089208-127089230 GTGACAATGAAGCCAGAGACTGG + Intronic
1032173585 7:129606184-129606206 GAGACACAGAAACTGGAAGCTGG - Intergenic
1032645904 7:133823709-133823731 GAGAGACTGAGGCAGGAGAATGG + Intronic
1033220251 7:139522949-139522971 GAGGAACTGAAGATGGAGACAGG + Intergenic
1034156784 7:148962105-148962127 GAGAGACTGAGGCAGGAGAATGG + Intergenic
1034333358 7:150303165-150303187 AAGACACAAAAGCTGGAGAATGG + Intronic
1034877942 7:154741876-154741898 GAGACACAGATGCAGGACACTGG - Intronic
1035184604 7:157116572-157116594 GGGAGACTGAGGCAGGAGACTGG - Intergenic
1036067243 8:5395668-5395690 GGGACACTGAGGCAGGAGAACGG - Intergenic
1036134378 8:6146359-6146381 AATAAACTGAAGCTAGAGACAGG + Intergenic
1036685447 8:10906354-10906376 TAGGCACTGAATTTGGAGACAGG - Intronic
1036810557 8:11865482-11865504 GAGAGACTGAGGCAGGAGAATGG + Intronic
1037045952 8:14303854-14303876 GGGAGACTGAAGCAGGAGAATGG - Intronic
1037178156 8:15971682-15971704 GAGAGACTGAGGCAGGAGAATGG - Intergenic
1037668811 8:20996985-20997007 GAGGCACTGGGGCTGGAGACGGG - Intergenic
1037691704 8:21186347-21186369 CAGACACTGGAGCAGCAGACAGG - Intergenic
1038034667 8:23676946-23676968 GAGAGGCTGAGGCTGGAGAATGG - Intergenic
1038286326 8:26209297-26209319 GAGAGGCTGAAGCAGGAGAATGG - Intergenic
1038497632 8:28015008-28015030 GAGACAGAGAAGCTTGAGATGGG + Intergenic
1038811980 8:30856440-30856462 CAGCAACTGAAGGTGGAGACGGG + Intronic
1040388437 8:46930242-46930264 GAGACAGAGAGGCTGTAGACAGG + Intergenic
1040775920 8:51043268-51043290 TAGGCCCTGAAGGTGGAGACAGG - Intergenic
1041059100 8:54018892-54018914 GAGACACTGTAGCTTAAGAGAGG + Intronic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041269832 8:56100787-56100809 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1041798784 8:61775269-61775291 GAGCCACTGAAGATGCAGCCTGG - Intergenic
1043094800 8:75953816-75953838 GATTCACTGAAGCTGGACATGGG + Intergenic
1043250497 8:78066837-78066859 GAGAGACTGAAGCAAGAGAAGGG + Intergenic
1045322374 8:101091781-101091803 GGGGCACTGAAGGTGGGGACAGG - Intergenic
1045816248 8:106280478-106280500 GAGATGATGAAGATGGAGACTGG - Intronic
1046064482 8:109180608-109180630 GATACACAGAAGATTGAGACTGG - Intergenic
1046177415 8:110596247-110596269 GAGACGCTGAGGCAGGAGAATGG - Intergenic
1047269689 8:123344448-123344470 GGGAGACTGAAGCAGGAGAATGG - Intronic
1047476248 8:125234086-125234108 GAGAGGCTGAAGCAGGAGAATGG + Intronic
1047646486 8:126875482-126875504 GGGAGACTGAAGCAGGAGAGTGG + Intergenic
1047764233 8:127977288-127977310 GGGAAACTGAAGCTGGAGTCTGG + Intergenic
1048401868 8:134079057-134079079 GAGATACTATAGGTGGAGACAGG + Intergenic
1048694466 8:137009846-137009868 GAGAAAATGAAGCTGCAGAAAGG - Intergenic
1048867716 8:138773007-138773029 CAGACACTGAGGCTGGGGACAGG + Intronic
1049048598 8:140172950-140172972 AAGATACTGAAGCTGGTGGCTGG + Intronic
1049441443 8:142611608-142611630 GAGCCACTGCAGCAGGAGTCGGG - Exonic
1049637909 8:143699127-143699149 GAGACACTGCAGCTGGAGGTGGG - Intronic
1052301253 9:26955269-26955291 AACACACTGATGCTGGACACTGG + Intronic
1052335565 9:27316242-27316264 GAGACGCTGAGGCAGGAGAATGG + Intergenic
1052728806 9:32261821-32261843 AAGACACTGAAACTGAAGCCTGG + Intergenic
1053173001 9:35904417-35904439 GAGAAACTGAAGCCAGAGAAGGG - Intergenic
1053250926 9:36573303-36573325 GAGTCACGGAAACTGGAAACGGG - Intronic
1053634175 9:39978162-39978184 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1053771574 9:41485337-41485359 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1054209712 9:62272535-62272557 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1054315280 9:63576423-63576445 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1056999282 9:91492702-91492724 GGGACAGTGATGCTTGAGACAGG + Intergenic
1057897901 9:98924421-98924443 GAGACACTGGGGCTTGAGACAGG - Intergenic
1058151698 9:101470590-101470612 GATACACTGGGGCTGGAGAAGGG + Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1059425231 9:114216767-114216789 GGGAGATTGAAGATGGAGACAGG + Intronic
1059639622 9:116203987-116204009 GAGACACTGAAAGCTGAGACTGG + Intronic
1059754797 9:117282480-117282502 GGGAAAATGAAGCTGGAGAATGG - Intronic
1059879521 9:118674673-118674695 ATGACACTGAGGCTGGAGAAAGG + Intergenic
1059978664 9:119745273-119745295 CAGTCACTGAACCTGGTGACAGG + Intergenic
1060018626 9:120109332-120109354 GAGAGACCGCAGCTGGAGAGTGG - Intergenic
1060075612 9:120588171-120588193 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1060084657 9:120686192-120686214 GAGAGGCTGAGGCTGGAGAATGG - Intronic
1060664781 9:125426322-125426344 GAGCTCCTGAAGCTGGAGAATGG + Intergenic
1061162255 9:128902150-128902172 GACACACTCAAACTGGAGAGAGG + Intronic
1061412561 9:130429434-130429456 GTGGCACTGAAACTGGAGAAGGG + Intronic
1061557009 9:131376900-131376922 GAGACACTGAGGCAGGAGGATGG + Intergenic
1061838305 9:133343352-133343374 GGGAAACTTAGGCTGGAGACAGG - Intronic
1062049749 9:134441125-134441147 GACACACTGAAGATGGGGAGTGG + Intergenic
1203746738 Un_GL000218v1:44370-44392 GGGACACAGAGGCTGGAGACGGG - Intergenic
1203563366 Un_KI270744v1:75110-75132 GGGACACAGAGGCTGGAGACGGG + Intergenic
1185783789 X:2872135-2872157 GGGACTCTGAAACTGGAGGCAGG - Intronic
1185973310 X:4688653-4688675 GAGACGCTGAGGCAGGAGAATGG - Intergenic
1187469186 X:19553086-19553108 GACACACTGCAGCTGGAGCCAGG + Intronic
1187689436 X:21849920-21849942 GAGAGGCTGAAGCAGGAGAACGG + Intronic
1189269717 X:39742546-39742568 GAGACACTAAAACTGGCCACTGG - Intergenic
1189535182 X:41927910-41927932 AATACACTGAAGCTGGAGTGAGG - Intergenic
1189608614 X:42706896-42706918 GGGACGCTGAGGCTGGAGAATGG + Intergenic
1189898998 X:45686521-45686543 GGGACACTGAAGCTGGAGGAGGG - Intergenic
1190093930 X:47463758-47463780 GAGCCTCTGAAGCTGCAGAATGG - Intronic
1190434111 X:50406606-50406628 GTGACAATGAAGGTGGAGATTGG + Intronic
1191868849 X:65728396-65728418 GAGAGGCTGAAGCAGGAGAATGG - Intronic
1192126926 X:68509755-68509777 AACTCACTGAAGCTGGAGAAAGG - Intronic
1193125254 X:77863917-77863939 GAGACGCTGAGGCAGGAGAATGG + Intronic
1193369714 X:80679947-80679969 GAGACACTAAAGATGTAAACTGG + Intronic
1196128855 X:112130896-112130918 GGGAGACTGAAGCAGGAGAATGG - Intergenic
1196187942 X:112764517-112764539 GAGACAGAGAAGCTGAAGAGGGG - Intergenic
1196465622 X:115969088-115969110 GAGACACAGAAGATGGAGGGAGG - Intergenic
1196679087 X:118452555-118452577 GGGAGACTGAAGCAGGAGAATGG + Intergenic
1196937985 X:120748681-120748703 GAGACTCTGAAGGGGGAGGCTGG + Intergenic
1197597814 X:128488219-128488241 GACACACTTAAGCTGGAGCCAGG + Intergenic
1198030822 X:132751854-132751876 GAAACTCTGAAGCTTGGGACTGG - Intronic
1198190640 X:134300844-134300866 GAGACAGTGAACTTGAAGACAGG + Intergenic
1199017315 X:142833501-142833523 GAGAGACTGAAGCAGGATTCTGG + Intergenic
1201160067 Y:11159384-11159406 GGGACACAGAGGCTGGAGACGGG - Intergenic
1202165008 Y:21978479-21978501 CAGACACTGAAGCTTGAGCCTGG - Intergenic
1202226348 Y:22607895-22607917 CAGACACTGAAGCTTGAGCCTGG + Intergenic
1202316767 Y:23587769-23587791 CAGACACTGAAGCTTGAGCCTGG - Intergenic
1202553998 Y:26082289-26082311 CAGACACTGAAGCTTGAGCCTGG + Intergenic
1202605267 Y:26634300-26634322 AAGACACTGATGATGAAGACTGG + Intergenic