ID: 1059398360

View in Genome Browser
Species Human (GRCh38)
Location 9:114053150-114053172
Sequence ATTAAGCTGTTAGTTGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059398360_1059398361 -2 Left 1059398360 9:114053150-114053172 CCTGCTGCAACTAACAGCTTAAT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1059398361 9:114053171-114053193 ATAAAACCCAAAGATCTCACAGG 0: 1
1: 0
2: 1
3: 36
4: 345
1059398360_1059398364 10 Left 1059398360 9:114053150-114053172 CCTGCTGCAACTAACAGCTTAAT 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1059398364 9:114053183-114053205 GATCTCACAGGTCCAGCCACTGG 0: 1
1: 0
2: 0
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059398360 Original CRISPR ATTAAGCTGTTAGTTGCAGC AGG (reversed) Exonic
903457753 1:23499828-23499850 CTCAAGCTCTGAGTTGCAGCAGG - Intergenic
906630591 1:47364010-47364032 CTAAAGCTGTTGTTTGCAGCAGG + Intronic
907751950 1:57271229-57271251 ATTAAGTGGATAGCTGCAGCAGG + Intronic
907811951 1:57879786-57879808 ATGAAGCTCTTAACTGCAGCAGG - Intronic
908734978 1:67266988-67267010 ATAAAGATCTTAGTTTCAGCAGG + Intergenic
909508640 1:76425048-76425070 ATTAAACTGTTATTTTCATCGGG - Intronic
910336980 1:86144730-86144752 ATTAAGCTTTTACTTGGAGGTGG + Intronic
910553490 1:88503026-88503048 ACTAAGCTGCTAAATGCAGCCGG - Intergenic
912847263 1:113085839-113085861 GTAAAGCTGTTAGTTGTAGAGGG + Intronic
913482170 1:119299243-119299265 ATAAAGCTGTTAGTTGATGCAGG - Intergenic
916686850 1:167155428-167155450 ATTCACCTGTTACTGGCAGCTGG - Intergenic
921136964 1:212269945-212269967 AGTAATCTGTCAGTAGCAGCAGG - Intergenic
922999125 1:229991428-229991450 CCCAAGCTGTTTGTTGCAGCTGG - Intergenic
923381833 1:233428182-233428204 AATAATATTTTAGTTGCAGCAGG + Intergenic
1068032549 10:51721294-51721316 ATTTTGCTGTTAGTTGGTGCTGG + Intronic
1070332692 10:75429788-75429810 CAGAAGCTGTTAGTTTCAGCTGG - Intergenic
1070433372 10:76363432-76363454 ATAAAGCTGTTAGAAGCAACAGG + Intronic
1074026957 10:109646078-109646100 ATTAAGCTCTTACTTGCTGATGG + Intergenic
1076235088 10:128857889-128857911 ATTAACCTGTTTGTTCCAGTTGG + Intergenic
1087367875 11:97244498-97244520 ATTAAGCTGTGAATTTCATCTGG + Intergenic
1091132913 11:133161473-133161495 TTAAAGCTGTGAGTGGCAGCTGG + Intronic
1091357654 11:134950036-134950058 ATTAAGCTGTTATTGGCTGTTGG + Intergenic
1093661571 12:21763567-21763589 ACTCAGCGTTTAGTTGCAGCTGG + Intergenic
1095942598 12:47736747-47736769 AAGAAGCTGTCAGTTGCATCTGG + Intronic
1101346133 12:103887936-103887958 ATCAAGCTGTGAGTAGCATCAGG - Intergenic
1101945107 12:109130597-109130619 ATTCAGCTGTAGGTTGCAGCAGG + Intronic
1102084639 12:110125689-110125711 ATTAAGCAATGAGTTGCTGCCGG - Intronic
1102865196 12:116368655-116368677 ATTACGCTGGTAGATGCGGCGGG - Intergenic
1104091779 12:125523736-125523758 ATTAAGCTGTAAGCTGGTGCAGG - Intronic
1107497081 13:40937153-40937175 ATTAAACTGTCAGTTGCGTCTGG + Intronic
1108541361 13:51450604-51450626 ATTAATCTGTTTGTTGCATCAGG - Intronic
1113461723 13:110486645-110486667 ATCAAGCTGTTAATTTCACCTGG + Intronic
1116377599 14:44223750-44223772 TTTAAGCTTTTACTTGAAGCTGG - Intergenic
1116711932 14:48379231-48379253 ATCAAGCTGTTGGTTGTAGCTGG + Intergenic
1118503885 14:66389831-66389853 ATAATGCTGTTAGTTGAATCTGG - Intergenic
1119204393 14:72783412-72783434 TTCAAGCTGTCAGTTGCAGGTGG - Intronic
1119588388 14:75860556-75860578 ATTAAACTATTAGTTACAACTGG - Intronic
1121910516 14:97787084-97787106 ATTAAGGTGTTGGTTGCTGAAGG - Intergenic
1121957226 14:98225624-98225646 ATTAGGTTGATATTTGCAGCAGG + Intergenic
1124843023 15:33262499-33262521 AGTGATCTGTTAGTTGCAGATGG + Intergenic
1127302708 15:57672472-57672494 GTACAGCTGTGAGTTGCAGCAGG + Intronic
1129543369 15:76370061-76370083 ATTAAGCTGTCTGCTGCAGGTGG + Intronic
1130291516 15:82606169-82606191 ATTAAGATGCTAGTTCCAGCTGG + Intronic
1130699651 15:86165636-86165658 ATGAAGCCGTTAGTTGGGGCTGG - Intronic
1131503356 15:92992550-92992572 AATAGGCTGTTAGTGGCAGCAGG - Intronic
1134784748 16:16931490-16931512 ATTAAGGTGTTTTTTGAAGCTGG + Intergenic
1141349804 16:83283734-83283756 ATTAAGGTCTTAGTTTGAGCTGG + Intronic
1145178526 17:20723389-20723411 ATTGAGCTGTCTGTAGCAGCAGG - Intergenic
1148956917 17:51361754-51361776 ACTAAAGTGTTAATTGCAGCAGG - Intergenic
1153900176 18:9611713-9611735 TTTAAAAAGTTAGTTGCAGCCGG + Intronic
1154497256 18:14971118-14971140 ATTAAGCTGTTATTGGCCGTTGG - Intergenic
1155423170 18:25677712-25677734 TTTAAGCTGTTAGATGCCTCAGG - Intergenic
1167349710 19:48966862-48966884 ATAAAGCTTTTTGATGCAGCTGG + Exonic
1167974282 19:53211264-53211286 ACTAAGCTTTTGGTTGCATCTGG + Intergenic
926277725 2:11417443-11417465 ATTCAGTTGTCAGTTCCAGCTGG + Intergenic
928675096 2:33642927-33642949 AGTAAGCTCTTAGTTGAATCTGG - Intergenic
932699460 2:73983703-73983725 GCTAAGCTGTTAGCTGCAGCCGG + Intergenic
946890469 2:224270581-224270603 AGTAAGATGTTAGTTACAACTGG + Intergenic
947480769 2:230497692-230497714 AATATGCTGTTAGATTCAGCAGG - Intronic
1169850770 20:10047897-10047919 ATTAAGCTGGAAGCTGCAGAGGG + Intronic
1170844326 20:19949425-19949447 ATTAGGCTGTGGGTGGCAGCAGG - Intronic
1171452299 20:25244727-25244749 GTTGAGCTGTTAGTTACAGGAGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174029712 20:47612917-47612939 ACTCAGGTGTTAGTTGCAACTGG - Intronic
1177772223 21:25529753-25529775 ATTTGGCTGTTAATTGCAGTGGG - Intergenic
1177902981 21:26939226-26939248 ATGAAGCTGTTAGATGCATTAGG + Intronic
1179540265 21:42079234-42079256 ATTAACTTGTTTGCTGCAGCAGG - Intronic
1181567721 22:23749986-23750008 ACTTAGCGGCTAGTTGCAGCCGG - Intronic
949835448 3:8264666-8264688 ATGAGGTTGTTTGTTGCAGCAGG - Intergenic
953465204 3:43113892-43113914 TACAAGCTGTTACTTGCAGCAGG + Intergenic
957575404 3:82001023-82001045 CTCAAGCTGTAAGTGGCAGCTGG - Intergenic
958931036 3:100208399-100208421 ATTAATCTGTCAGTCCCAGCTGG - Intergenic
963235980 3:142956637-142956659 ATTTAGCTGTTAATTGTGGCAGG - Intronic
965336038 3:167431616-167431638 ATAAAGCTGTTTGTTTCACCTGG - Intergenic
966470521 3:180283771-180283793 TTTACTCTGCTAGTTGCAGCAGG - Intergenic
969897749 4:10321009-10321031 AATGAGCTGTTAGATGCACCTGG + Intergenic
969920351 4:10532679-10532701 ATGAAGCTGTCAGGTGCAGTGGG + Intronic
973649426 4:52983499-52983521 ATTAAGCTGCTTGTTGTAGTGGG + Intronic
975053829 4:69902484-69902506 ATTAAGCTGTAAGTTACTGAAGG - Intergenic
975713665 4:77185366-77185388 ATCAAGCTGTTTTTTGAAGCTGG - Intronic
977411941 4:96677472-96677494 CTAAAGCTGTTAGTTTCTGCTGG + Intergenic
981366822 4:143913471-143913493 ATTAAGCTGTCAGTTCCTGAAGG - Intergenic
981376619 4:144023708-144023730 ATTAAGCTGTCAGTTCCTGAAGG - Intergenic
981387123 4:144145053-144145075 ATTAAGCTGTCAGTTCCTGAAGG - Intergenic
981651189 4:147060998-147061020 ATTAGGCTGTTCCTTTCAGCAGG + Intergenic
981705299 4:147653149-147653171 ATTAAGATCTTGGTTTCAGCCGG + Intronic
983197103 4:164819069-164819091 ATAAAGCTGTTAAATGCATCAGG - Intergenic
984176118 4:176419069-176419091 ATTCAGCTGTGACTTGCAGAAGG + Intergenic
984363803 4:178771820-178771842 ATTAAGCTTTAAGTTCCAGTTGG - Intergenic
984606632 4:181793204-181793226 ATTAAGCTCTTTCATGCAGCTGG - Intergenic
987750811 5:22037161-22037183 ATTAAGGTGTGAGGTGGAGCAGG - Intronic
988200391 5:28061933-28061955 ATTTAGCTGTTATTTGCAAAGGG + Intergenic
993462573 5:88202030-88202052 ATTAAGCACTTAATTCCAGCTGG + Intronic
995565447 5:113429367-113429389 ATTAAGATGCTAGTTGATGCTGG - Intronic
995899722 5:117051863-117051885 ATAAAGCTGTTTGTTTCACCTGG + Intergenic
999237514 5:150107927-150107949 AATAGGCTGTGAGTTGCAGAAGG - Intronic
1000703025 5:164476637-164476659 ATTAAACAGTAAATTGCAGCTGG + Intergenic
1002029573 5:176417665-176417687 ATTAAACTGAAAGTTCCAGCTGG - Intergenic
1005250683 6:23942454-23942476 ATAAAGCTGGTTTTTGCAGCTGG - Intergenic
1007401128 6:41602992-41603014 AGTAGGCTGTTAACTGCAGCTGG + Intergenic
1007425688 6:41744528-41744550 AGCAAGCTGTTAGTTCCAGAGGG + Intronic
1014967161 6:127769729-127769751 ATTAAGCTGTCATTTGCATTAGG + Intronic
1015712525 6:136157695-136157717 ATTCTGCAGATAGTTGCAGCGGG + Intronic
1015903036 6:138087149-138087171 AATAAGCTTCTAGTTGCAACTGG - Intergenic
1016621409 6:146113329-146113351 ATGAAGCTTTAAGTTGCAGCAGG - Intronic
1018155631 6:160983014-160983036 ATTATGCTGTTAGAAGCAACTGG - Intergenic
1019508248 7:1404384-1404406 ATTAAGCAGTTAATTGCGCCGGG - Intergenic
1020113655 7:5462628-5462650 ATTAAGATGTCATTTGCGGCTGG - Intronic
1024374852 7:48625471-48625493 ATTCAGTGGTTAGTAGCAGCAGG - Intronic
1029407416 7:100383931-100383953 TTTAAGCTGTGAGTTGGGGCCGG - Intronic
1034365256 7:150540667-150540689 GGTAAGCTGTTAGAAGCAGCTGG + Intergenic
1047692599 8:127371594-127371616 ATTAAGCTGTGGGTAGCAGCAGG - Intergenic
1052559509 9:30067006-30067028 ATTAAGCAGTTAATTACAACAGG + Intergenic
1053239217 9:36482857-36482879 ATGAAACTGTTAGTTACAGCTGG + Intronic
1058197342 9:101994327-101994349 AGTAAGCAGTTATATGCAGCTGG - Intergenic
1059398360 9:114053150-114053172 ATTAAGCTGTTAGTTGCAGCAGG - Exonic
1186500851 X:10049428-10049450 TTGAAGCTGTTAGATGCATCTGG - Intronic
1187670931 X:21665249-21665271 ATTTAGATGCTAGTTGCAGATGG - Intergenic
1188569740 X:31569708-31569730 AGTAAGATGTTAGTTACAGTTGG - Intronic
1188572429 X:31604034-31604056 AATAAGCTGTTGGTGGCAGGAGG - Intronic
1198607420 X:138356770-138356792 ATGAAGCTGGTTCTTGCAGCAGG + Intergenic
1198819065 X:140626211-140626233 ATAAAGATGTTAGTTGCTGAAGG - Intergenic