ID: 1059404807

View in Genome Browser
Species Human (GRCh38)
Location 9:114093081-114093103
Sequence GCCTAGGGCTCCCTCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059404807_1059404816 24 Left 1059404807 9:114093081-114093103 CCAGGGCAGAGGGAGCCCTAGGC 0: 1
1: 0
2: 4
3: 48
4: 328
Right 1059404816 9:114093128-114093150 GCCTGCAGCCCTGGAATCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 473
1059404807_1059404819 26 Left 1059404807 9:114093081-114093103 CCAGGGCAGAGGGAGCCCTAGGC 0: 1
1: 0
2: 4
3: 48
4: 328
Right 1059404819 9:114093130-114093152 CTGCAGCCCTGGAATCCCTGGGG 0: 1
1: 0
2: 7
3: 48
4: 342
1059404807_1059404815 15 Left 1059404807 9:114093081-114093103 CCAGGGCAGAGGGAGCCCTAGGC 0: 1
1: 0
2: 4
3: 48
4: 328
Right 1059404815 9:114093119-114093141 CATGATCTAGCCTGCAGCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 153
1059404807_1059404818 25 Left 1059404807 9:114093081-114093103 CCAGGGCAGAGGGAGCCCTAGGC 0: 1
1: 0
2: 4
3: 48
4: 328
Right 1059404818 9:114093129-114093151 CCTGCAGCCCTGGAATCCCTGGG 0: 1
1: 1
2: 5
3: 34
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059404807 Original CRISPR GCCTAGGGCTCCCTCTGCCC TGG (reversed) Intronic
900120546 1:1046936-1046958 GCAGAGGGCTCCAACTGCCCCGG + Exonic
900214146 1:1472136-1472158 GGCCAGGGCTCCCGCTTCCCCGG - Intronic
900221694 1:1512520-1512542 GGCCAGGGCTCCCGCTTCCCCGG - Intronic
900368129 1:2319810-2319832 GCCTTGGGGACACTCTGCCCTGG + Intergenic
900591938 1:3464040-3464062 GGCCTGGGCTCCATCTGCCCCGG + Intronic
900900023 1:5509861-5509883 GCCTGGGGCTCCCTGGGCACGGG + Intergenic
901207067 1:7503453-7503475 GCCTGGGTCTCCCTCTGGCCTGG + Intronic
901454238 1:9354096-9354118 GCCTAGAGCTCCCTCTCAGCTGG - Intronic
901489932 1:9591509-9591531 TCCTAGGCCTCCCTGTCCCCTGG + Intronic
901756546 1:11444769-11444791 GCCCAGGCAGCCCTCTGCCCAGG - Intergenic
903057890 1:20649050-20649072 GGCGATGGCTCCCACTGCCCAGG - Exonic
903060315 1:20664454-20664476 CCTGAGGGCTCCCTCAGCCCTGG - Exonic
903063756 1:20687035-20687057 GCCCAGGGCTCCGTCAGGCCTGG + Intronic
903738081 1:25543229-25543251 TCCTAAGTCTCCCACTGCCCTGG + Intergenic
904160291 1:28518123-28518145 GCCAAGGGCTCCCCCAGCCCGGG + Intronic
906113154 1:43337960-43337982 TCCCAGGGCTCCCTCTTCCTGGG - Intronic
906146438 1:43563496-43563518 TCCTGGGGCTCCTTCTGTCCTGG - Intronic
906457643 1:46010797-46010819 GCTCAGGGCTCCATCTGCCAAGG - Exonic
907283112 1:53363478-53363500 GCCTTGCCCTCCCTCTGCCTGGG + Intergenic
908168707 1:61483945-61483967 GCCCAGGGCTCCCTTTCCCCTGG - Intergenic
908433570 1:64082604-64082626 GCTGAGGTCACCCTCTGCCCAGG + Intronic
910288140 1:85576864-85576886 GCCCAGGCCTCCCTCCGCGCGGG - Intronic
910968724 1:92832646-92832668 GCCGAGGGGTCCCTGGGCCCCGG + Intronic
911931335 1:103908059-103908081 GACTGGGTCTCACTCTGCCCAGG + Intergenic
912936923 1:114011787-114011809 GCCTTGGCCTCCCACAGCCCTGG + Intergenic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
914675414 1:149904194-149904216 GCCTAGGGCTCCTCCATCCCAGG + Exonic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
915590458 1:156867415-156867437 GCATGGGGCTCCCTCACCCCAGG - Intronic
916085867 1:161268796-161268818 GCCTTGGGCTCCCAAAGCCCTGG + Intronic
919907396 1:202087258-202087280 CCCTCTGGCTCCCTCTGCCAGGG - Intergenic
920375175 1:205504488-205504510 CCCCAGGGCTCCCTCTGCCCGGG - Intergenic
920609224 1:207421463-207421485 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
921055222 1:211538149-211538171 GTCTAAGGCTCCCTTTGCTCCGG + Intergenic
921914683 1:220594001-220594023 ACTTCTGGCTCCCTCTGCCCAGG + Intronic
923093866 1:230759627-230759649 GCCCAGGGCTCCCTCTTACCTGG - Exonic
923549903 1:234955282-234955304 GGCTTGGGCTCCATCTGCCTCGG + Intergenic
924708549 1:246517021-246517043 GCCTATGTCACCGTCTGCCCAGG + Intergenic
1062925376 10:1312338-1312360 GCCGGGGGCTCACTCTGACCTGG - Intronic
1063367051 10:5497113-5497135 TCCCAGGGCTCCCTTTGTCCTGG - Intergenic
1066065553 10:31759250-31759272 GCCTATGCCGCCCTCTCCCCGGG + Intergenic
1067225337 10:44372728-44372750 GGCTGGGTCTCACTCTGCCCTGG + Intronic
1067535006 10:47102656-47102678 GCCTGAGACTCTCTCTGCCCTGG + Intergenic
1067540900 10:47152026-47152048 GCCCTGGGTTCCCTCTGCCCTGG + Intergenic
1067582935 10:47456982-47457004 GCATGGGACTCCCTCTGCCCAGG + Intergenic
1067801261 10:49361026-49361048 GCCTAGGGCCTCTCCTGCCCTGG - Intergenic
1069752409 10:70752796-70752818 CCCTGGGGCTCCCCCAGCCCAGG - Intronic
1069882744 10:71603680-71603702 GACTGGTGCTCCCTCAGCCCTGG - Intronic
1070705190 10:78632325-78632347 CTCTGGGCCTCCCTCTGCCCAGG + Intergenic
1071433230 10:85622953-85622975 GCCTAGAGCTCCCTGTGCATGGG + Intronic
1071506670 10:86236551-86236573 GCCTAGGGCTCAAGCTGTCCTGG - Intronic
1071955628 10:90756187-90756209 GCTTAGGACTTCCTCTTCCCCGG - Intronic
1075280398 10:121133780-121133802 GCCAAGGGTCCCCCCTGCCCAGG - Intergenic
1075346252 10:121683921-121683943 CCCTAGGGCACCTCCTGCCCTGG - Intergenic
1075545635 10:123352328-123352350 GCCTGGGCCTCCCTCTGGCCAGG + Intergenic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1076830271 10:132991002-132991024 GCTGAGCGCTCCATCTGCCCGGG - Intergenic
1077108635 11:852672-852694 GCCTAGCGCTCCCCTTCCCCAGG + Intronic
1077229998 11:1454463-1454485 GCCTCTGTCTCCCACTGCCCAGG + Exonic
1077384375 11:2262038-2262060 GCCTAGGGCCCCGTGTGGCCTGG - Intergenic
1077467890 11:2742282-2742304 GCACAGGGCTTCCCCTGCCCTGG - Intronic
1077472424 11:2770272-2770294 GCCCAGGGCTGCCTGTGCCAGGG - Intronic
1077487439 11:2845583-2845605 ACATGGGGCTCCCTCTGGCCTGG + Intronic
1077530613 11:3093085-3093107 GCCTAGGGGTCGGGCTGCCCGGG - Intronic
1078085130 11:8229386-8229408 TCATGGGGCTCCCTCTGCCCAGG - Intronic
1078315919 11:10293692-10293714 TCTCAGGGCTCTCTCTGCCCCGG + Intronic
1078480249 11:11669152-11669174 CCCTAGGGATGCCTCTGTCCAGG + Intergenic
1078857957 11:15221658-15221680 TCCTAGTGGTCCCGCTGCCCAGG - Intronic
1079104480 11:17561497-17561519 GCCTGTGTCTCCCACTGCCCAGG + Intronic
1079128290 11:17733976-17733998 TCCTAGGGCTTCAACTGCCCTGG - Intergenic
1079373655 11:19872925-19872947 GCTTGGGCCTCCCTTTGCCCTGG + Intronic
1080768309 11:35317239-35317261 GCCTAGGGCCCTGTCTGCCCAGG - Intronic
1081617706 11:44600383-44600405 GCCCATGGCTCCCTCTGCAGGGG + Intronic
1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG + Intergenic
1083155571 11:60820909-60820931 GGCTGGGGCTGCCACTGCCCTGG + Intergenic
1083184062 11:61007500-61007522 GCCTGGGCAACCCTCTGCCCAGG + Intronic
1083472169 11:62891336-62891358 GCCTTGGCTTCCCTCTGCCTAGG + Intergenic
1083741907 11:64715732-64715754 TCCAAGGACTGCCTCTGCCCGGG + Intronic
1083977425 11:66134670-66134692 GGGTAGGGCTCCCTGTACCCTGG + Intronic
1084184680 11:67465185-67465207 GCCTAGGGCACCTTCAGCTCAGG - Intronic
1084518481 11:69648937-69648959 GCCTAGTGGTGCCTCTGTCCCGG + Intronic
1084604017 11:70162203-70162225 GCCTGGGGTCCCCACTGCCCGGG - Intronic
1084604048 11:70162279-70162301 GCCTGGGGTCCCCACTGCCCGGG - Intronic
1084604061 11:70162311-70162333 CCCTGGGGTCCCCTCTGCCCAGG - Intronic
1085521109 11:77139363-77139385 GCCTGGGAAACCCTCTGCCCTGG + Intronic
1087174411 11:95082911-95082933 GACAAGGGCTCACTCTGCACTGG + Intergenic
1088818401 11:113436937-113436959 CCCCAGGGCTCCATCTGTCCTGG - Intronic
1089281377 11:117377109-117377131 GCTTAGGGCTTCCTCTGCCAGGG - Intronic
1093164568 12:15789786-15789808 CCCGAGCGCTCCCTCCGCCCGGG - Intronic
1093207471 12:16267983-16268005 GCCTAGGCCTCCCAGAGCCCAGG + Intronic
1095084890 12:38050344-38050366 ACCAATGGCTCCCTCTACCCTGG - Intergenic
1095971369 12:47904164-47904186 ACCTAAGGCTCCCCCAGCCCAGG + Intronic
1096220452 12:49825738-49825760 GCCTGGGAAGCCCTCTGCCCTGG - Intronic
1097173051 12:57128217-57128239 GCCTGGGGCGCCCTCTCCCCTGG - Intronic
1102236763 12:111298619-111298641 GCCAGAGGCTCCCTCTGCCTGGG + Intronic
1102456161 12:113071955-113071977 GCCCAGGCCTCCCTCTCTCCAGG - Intronic
1102509184 12:113402753-113402775 GGACAGGGCTCCCTCTGCCGCGG + Intronic
1103569093 12:121832286-121832308 GACTAGACCTCCCTCTCCCCAGG + Exonic
1104947726 12:132424054-132424076 GCCTGGGGATCCCGCAGCCCAGG - Intergenic
1105971410 13:25432251-25432273 CCCCAGTGCTGCCTCTGCCCTGG - Intronic
1107454931 13:40546242-40546264 CCCTGGAGCTGCCTCTGCCCTGG + Intergenic
1107561156 13:41558737-41558759 CCTTAGGGCTCCTTCTGCACAGG + Intergenic
1108441491 13:50457641-50457663 GCCAAGAGCTCCCTGTGTCCAGG + Intronic
1108746296 13:53397964-53397986 CACTGGGGCTGCCTCTGCCCAGG - Intergenic
1110687289 13:78389910-78389932 GCCTAGGTCTCCATCTTCTCAGG + Intergenic
1111951738 13:94713366-94713388 GCCCAGGCCGCCCTCTGCACCGG + Intergenic
1113670235 13:112171128-112171150 GCCTAGAGCTCCTTCTGCAGCGG + Intergenic
1113910083 13:113837587-113837609 GTCTGGGGTTCCCTCAGCCCAGG - Intronic
1115705451 14:35993711-35993733 GACTATGGCTTCTTCTGCCCTGG - Intergenic
1118697404 14:68398170-68398192 GCCCAGCTCTCCCTCTGACCAGG + Intronic
1118710193 14:68512562-68512584 GCCTAAGCCCACCTCTGCCCTGG + Intronic
1118717046 14:68567738-68567760 GCATAGATCTCCCTCTTCCCAGG + Intronic
1118776307 14:68976554-68976576 GCCCAGAGCTCCTTCTGCCATGG + Intronic
1118849646 14:69573859-69573881 GCCTGGGTCTCCCTCAGCCCCGG + Intronic
1120668519 14:87336301-87336323 TGCTAGGACTCCCTCAGCCCTGG + Intergenic
1120853500 14:89192880-89192902 CCCTGTGGCTCCCACTGCCCCGG + Intronic
1121525067 14:94613951-94613973 GCCCAGGGCTCCTTCATCCCTGG + Exonic
1121855786 14:97268970-97268992 GCCCAGGGCCACCTCTGGCCAGG + Intergenic
1122072380 14:99213050-99213072 GTCTAGGGTCCCCTCTCCCCTGG - Intronic
1122320312 14:100851543-100851565 GCCCAGGCCACCCTCTGGCCTGG + Intergenic
1122601191 14:102922784-102922806 GCCTAGAGCGACCTCGGCCCTGG - Intronic
1123459798 15:20459493-20459515 GCCCATGGCACCCTCTGCCCTGG + Intergenic
1123658264 15:22540927-22540949 GCCCATGGCACCCTCTGCCCTGG - Intergenic
1124266028 15:28235330-28235352 GCCCATGGCACCCTCTGCCCTGG + Intronic
1124312129 15:28635419-28635441 GCCCATGGCACCCTCTGCCCTGG - Intergenic
1124390376 15:29250314-29250336 TCCTAGGTGTCCCTCTGCCTTGG - Intronic
1125316865 15:38441315-38441337 CCCTTGGGCTCCCACTGCCTGGG - Intergenic
1125710720 15:41783634-41783656 GCTTGGGGCTCCCTCTGCTCAGG - Intronic
1128560875 15:68667040-68667062 CCCTAGGCTTCCCTCTCCCCAGG + Intronic
1129263208 15:74380623-74380645 GGCTACTACTCCCTCTGCCCTGG + Intergenic
1129333919 15:74841344-74841366 GCAGAGGCCTCCCTCTGCCTGGG - Intronic
1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG + Intronic
1129519440 15:76176624-76176646 GCCTGTGGCTCTCTGTGCCCAGG + Intronic
1130024617 15:80260562-80260584 GCTCAGGGCTCCCCATGCCCTGG - Intergenic
1130103570 15:80912355-80912377 GCCAAGGTCTCCCTCCGGCCTGG + Intronic
1130268687 15:82431972-82431994 CCCTTGGGCTCCCTGTCCCCAGG - Intronic
1132085789 15:98907369-98907391 CCCTAAGGCTTCGTCTGCCCTGG - Intronic
1132432856 15:101774852-101774874 GGCTAGTGCTGCCTCTGGCCTGG + Intergenic
1133239057 16:4403913-4403935 GCCTCGAGCTCACTCTGCCTGGG + Intronic
1134091041 16:11391898-11391920 GTCTGGGGCTCTCTCTGCCCTGG - Intronic
1136029204 16:27490442-27490464 GCCCTGAGCTCCCACTGCCCCGG - Intronic
1136077429 16:27826645-27826667 GCCTGGGGCACGCTCTGCCATGG - Intronic
1136990489 16:35148658-35148680 GCCAGGGGCTCCCTCTGCATGGG + Intergenic
1138360618 16:56424975-56424997 GCCTAGGGGCCCCTCCGCCAGGG - Intronic
1138554287 16:57762901-57762923 CCCTGCAGCTCCCTCTGCCCCGG + Intronic
1139357316 16:66374367-66374389 ACCCAGACCTCCCTCTGCCCTGG + Intronic
1140133658 16:72186022-72186044 GGCTAAGGCTCCCTCTCTCCAGG + Intergenic
1140701560 16:77586277-77586299 GCCTATAGCTCCCTCTTCCATGG - Intergenic
1141137322 16:81474726-81474748 TCCTGGGGCTCCCTCTCCTCTGG + Intronic
1141323348 16:83032772-83032794 GAATAGGGCTGACTCTGCCCTGG - Intronic
1141920275 16:87131055-87131077 GCCTGGAGCCCCCTGTGCCCTGG + Intronic
1142132836 16:88438666-88438688 GGCGAGGGCTTCCACTGCCCTGG - Exonic
1142182169 16:88676616-88676638 GAGTGGGGCTCCCACTGCCCGGG + Intergenic
1142302881 16:89268895-89268917 GCCTGGGGCTCACCCTGGCCCGG + Intronic
1142593968 17:1020718-1020740 GCGTGGAGCACCCTCTGCCCTGG - Intronic
1142917536 17:3154147-3154169 CCTCAGGGCCCCCTCTGCCCAGG - Intergenic
1143021629 17:3919670-3919692 TCCTCGGCCTCTCTCTGCCCTGG + Intergenic
1144061053 17:11583545-11583567 GCCCAGGGCTCCCCCTTGCCTGG + Intergenic
1144829857 17:18125237-18125259 GCCTGGGGCTGGCCCTGCCCTGG + Intronic
1145062013 17:19739474-19739496 GCCTGGGGTGCCCTCTGCCAGGG - Intronic
1145760494 17:27422773-27422795 GCCAAGGGCTCCCCTGGCCCAGG + Intergenic
1146547069 17:33748977-33748999 GCCGAGGGCCCCCTGAGCCCAGG - Intronic
1147786176 17:42980304-42980326 GTCTAGGGCAGCCTTTGCCCTGG - Exonic
1148210238 17:45804296-45804318 TCATAGGGGTCTCTCTGCCCTGG - Intronic
1148680607 17:49471322-49471344 GTCCAGGGCTCCCTCTGCGGAGG - Intronic
1148756979 17:49978351-49978373 GCCTAGGGTTCCCCTTGACCTGG + Intergenic
1148861590 17:50607252-50607274 GCCTAGGCCTCCCAATGCACTGG - Intronic
1149994397 17:61399338-61399360 GCCTGGGGGTCCCTGCGCCCCGG - Intergenic
1151429275 17:74051580-74051602 CCCTAGGGCTTCCCCAGCCCGGG - Intergenic
1152111333 17:78359270-78359292 GACTGGGGCACCCACTGCCCCGG + Intronic
1152224078 17:79084700-79084722 GCCCAGGCCTGCCTCTGCCCAGG + Intronic
1152561473 17:81081002-81081024 GGCCAGTGCTCCCTCAGCCCCGG - Intronic
1152687551 17:81701979-81702001 GCCTGGGGCTCCCTCTGCAGGGG + Exonic
1153636327 18:7117062-7117084 GCCTGCGGGTCCCCCTGCCCGGG + Intronic
1154163544 18:11997344-11997366 GCCTCCAGCTCCCACTGCCCAGG - Intronic
1156727459 18:40146831-40146853 GACAAGGTCTCCCTATGCCCAGG + Intergenic
1157585257 18:48797002-48797024 GCACTGGCCTCCCTCTGCCCAGG + Intronic
1157660800 18:49441832-49441854 GCCTGGGGGTCTCTCTCCCCAGG + Intronic
1157908993 18:51597578-51597600 GCCTAGGCCTCCCTAAGCCCTGG + Intergenic
1159456511 18:68666272-68666294 CCCTAGGGCTGCCTCTACTCTGG + Intergenic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697594 19:492174-492196 GCCTGGGGCTGGCTCCGCCCAGG - Intronic
1160897841 19:1411067-1411089 GCCTTGTGCTCACTCTGCACAGG - Intronic
1161937918 19:7383360-7383382 GCCCAAGGGTCCCTGTGCCCAGG - Exonic
1162153257 19:8660133-8660155 GCCCTGGGCTCCGGCTGCCCAGG + Intergenic
1162240418 19:9348744-9348766 GCCTAGGCCTCACTCAGCTCAGG + Intronic
1162298993 19:9833371-9833393 GCCTTGGGCTCCCAAAGCCCTGG + Intergenic
1162344189 19:10110254-10110276 GCCCGGGGGTCCCCCTGCCCTGG - Intronic
1163291722 19:16383613-16383635 CCTCTGGGCTCCCTCTGCCCAGG + Intronic
1163722451 19:18904758-18904780 GCCTAGGGCTCACCGTGGCCAGG + Exonic
1164492373 19:28727214-28727236 GACTTGGGGTCGCTCTGCCCCGG + Intergenic
1164936881 19:32222206-32222228 GCCAAGGGCTCCCCTTGGCCTGG + Intergenic
1165144867 19:33724601-33724623 GCCTGGGGCTGCATCTGCCTCGG + Intronic
1165926369 19:39328548-39328570 GCCGAGACCTCTCTCTGCCCAGG - Exonic
1166354130 19:42217166-42217188 GCCTCGGCCTCCCCCTCCCCCGG + Intronic
1166715546 19:44964900-44964922 GCCCTGGGGTCCCACTGCCCAGG - Intronic
1166731965 19:45064280-45064302 GCCGCGGCCCCCCTCTGCCCCGG - Intronic
1166781599 19:45346197-45346219 CCCTAGGCCTCCCCCTGCCCCGG - Intronic
1166872068 19:45876990-45877012 GCCTGGGGCTTCCTGTCCCCAGG + Intergenic
1168724008 19:58570825-58570847 GCCCTGGAATCCCTCTGCCCTGG + Intronic
925376436 2:3389239-3389261 GCCCAGGCCTCTCTCGGCCCAGG + Intronic
925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG + Intergenic
927691735 2:25213290-25213312 GCCTAGAGCGTCCTCTGCCTAGG + Intergenic
927862921 2:26571270-26571292 CCCAGGGGCTCCCCCTGCCCTGG + Intronic
929015266 2:37487359-37487381 GCCTTGGGCTGCCTCAGCGCTGG + Intergenic
930512202 2:52359274-52359296 GCCTGGGGCTCACTTGGCCCTGG + Intergenic
930730646 2:54724818-54724840 GCGCCGGGCTCCCTCTACCCGGG - Exonic
932822122 2:74910694-74910716 TCATAGGCCTCCCACTGCCCTGG + Intergenic
932934092 2:76081031-76081053 GCCTGGGGCTACCTCTATCCCGG - Intergenic
933667053 2:84971838-84971860 GCCTAGCGCTCCCGCCGCCCCGG + Intronic
933699356 2:85243653-85243675 GCCTGGGGCTGCCTCTGGCCAGG - Intronic
934233640 2:90210079-90210101 GCCTGGGGCTCCTGCTGCTCTGG + Intergenic
934515835 2:94985855-94985877 GCCTCAGGCTTCCTCAGCCCTGG + Intergenic
934552012 2:95268452-95268474 GCCTAGCCCTACCTCTTCCCGGG + Intergenic
936090672 2:109499550-109499572 AGCTGGGCCTCCCTCTGCCCTGG - Intronic
936341783 2:111640125-111640147 GCCTTGGCCTCCCTTGGCCCTGG - Intergenic
937826299 2:126371796-126371818 GCCTATGCCTCCCTCGGCCTAGG - Intergenic
937826629 2:126373898-126373920 GCCTATGCCTCCCTCGGCCTAGG + Intergenic
937952352 2:127398286-127398308 GCCCAGGACTGCCTCAGCCCCGG + Intergenic
938466856 2:131530358-131530380 GCCTAGGGCTCTCCCTTCCCAGG + Intronic
938839342 2:135144032-135144054 GCCCAGGCCTCACTCAGCCCTGG + Intronic
942454615 2:176129582-176129604 GCCAAGGGCTCCGTGTGCCCCGG - Intergenic
943111463 2:183611326-183611348 CCCTAGGGCTCTCCCTTCCCTGG - Intergenic
944051519 2:195475495-195475517 GCCTGCGGCTCCATCTGCCAAGG + Intergenic
947529082 2:230897320-230897342 GCCTTGGTCTCCCTCAGTCCTGG + Intergenic
947615992 2:231557272-231557294 GCCTGGTGGCCCCTCTGCCCTGG - Intergenic
947795156 2:232889973-232889995 GCCAATGGCTCCCTCTGCCCAGG + Intronic
948647961 2:239420628-239420650 GCCTTGGGCTGCATCTGCACAGG - Intergenic
948691277 2:239706673-239706695 CCCTCTGGCTCCCTCTGACCTGG - Intergenic
948868291 2:240786142-240786164 GCCGAGGGCTCCCCCTGTGCAGG - Intronic
948920448 2:241063799-241063821 CCCTGGGGGTCCCTCTCCCCAGG - Intronic
949022970 2:241751881-241751903 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
949022985 2:241751918-241751940 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
949023000 2:241751955-241751977 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
1169075220 20:2755989-2756011 CCCTCTGGCCCCCTCTGCCCTGG + Intronic
1170571407 20:17634834-17634856 GACTATGGCTCCCTCTGACGTGG - Intronic
1172509530 20:35490779-35490801 GCATAGGGCACTCTCTGCCTGGG - Exonic
1174114037 20:48214691-48214713 GCCTGGGGCTGGCTGTGCCCTGG + Intergenic
1175125862 20:56750920-56750942 GGTTAGGGCTCCCTTCGCCCAGG - Intergenic
1175143651 20:56879732-56879754 GCCTTGGCCTCCCACTGTCCTGG - Intergenic
1175981176 20:62739441-62739463 GCCTGGGGCCCCCTGAGCCCAGG + Intronic
1176082525 20:63281183-63281205 GCCTGGGGCAGCCTCTGCCTTGG + Intronic
1176085396 20:63293449-63293471 GCCCCGGGCTCCCACTGCCCCGG - Intronic
1178834521 21:36085287-36085309 ACCAAGGGTTCCCTCAGCCCAGG + Intergenic
1179399571 21:41071129-41071151 GCCAAGAGCCCACTCTGCCCGGG + Intergenic
1180009592 21:45040643-45040665 GCCTTGGGCTCCTTCTGCGAAGG - Intergenic
1180141453 21:45895931-45895953 GCCGAGGTCTGCATCTGCCCAGG - Intronic
1180784121 22:18537412-18537434 GCCCAGGGCGCTCTCTGCACAGG - Intergenic
1181127689 22:20711461-20711483 GCCCAGGGCGCTCTCTGCACAGG - Exonic
1181241023 22:21476764-21476786 GCCCAGGGCGCTCTCTGCACAGG - Intergenic
1181440527 22:22933206-22933228 GCCTGGAGCTCCCTTGGCCCAGG + Intergenic
1181633050 22:24161470-24161492 TCCTAGTTCTCCCTCAGCCCTGG - Intronic
1182095395 22:27622147-27622169 TCCGAGGGCTCGCTCTGCCCCGG - Intergenic
1182159047 22:28103467-28103489 CCCTACTGCTCCCTCTCCCCTGG - Intronic
1182227742 22:28812644-28812666 GCCTAGGCCTCCCTAAGCACTGG + Intergenic
1182282440 22:29225247-29225269 CTCCAGGGCTCCCTCAGCCCAGG - Intronic
1182327462 22:29524628-29524650 GCCCTGGGCTCCCTCTGCTGGGG + Intronic
1183540795 22:38428279-38428301 ACCTAAGACTTCCTCTGCCCCGG + Intronic
1183805105 22:40202682-40202704 GACTAGGGATCCCTGTGGCCAGG - Intronic
1183980085 22:41534227-41534249 GCCTGGGGCTCCCTGGGCGCAGG - Intronic
1184184227 22:42853634-42853656 GCCCAGAGCTCCCTGTGCCTTGG + Intronic
1184496906 22:44847217-44847239 GGGAAGGGCTCCCTCTGGCCAGG - Intronic
1184858601 22:47160528-47160550 GCCTAGACCTCCCACTGCCCCGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950407503 3:12813927-12813949 GCCTAGGGGCATCTCTGCCCTGG - Intronic
952531341 3:34265264-34265286 GCTTATGGCTCCCTCTTCTCCGG + Intergenic
952751774 3:36830827-36830849 GCCCAGGTCTCACTCTGCCTGGG + Intronic
953766427 3:45746909-45746931 GCCTAGGGCTCTCCCTTGCCTGG - Intergenic
954098698 3:48352824-48352846 ACCTAGACCTCCCTGTGCCCGGG - Intergenic
957614125 3:82506208-82506230 GCTTGGGGCTCCCTCAGCCAGGG + Intergenic
958735712 3:98007278-98007300 GCCTTGTCCTCCCTCTGCCTGGG - Intronic
958977337 3:100682611-100682633 GCCTGGGGCTCCCCCTTGCCTGG - Intronic
961203531 3:125062889-125062911 AGCAAGGGCTCCCTATGCCCGGG - Intergenic
961369691 3:126421945-126421967 GCCTAGGGCTCCCTCAGCCATGG + Intronic
962404618 3:135090217-135090239 GCCTATGGCTGGCTCTGCTCAGG + Intronic
963084268 3:141422246-141422268 GCATGGGGCTCCCCCTACCCAGG - Intronic
967322237 3:188206100-188206122 GCCTAGAGCTCCCTTACCCCTGG + Intronic
968502147 4:955751-955773 GCCGAGGGCTCCCTGTGGCCTGG - Exonic
968788196 4:2640219-2640241 GCCTTGGGCACCCTCAGACCTGG - Intronic
969369086 4:6719928-6719950 GCCTAGGCCTCCCAAAGCCCTGG - Intergenic
969439487 4:7208778-7208800 GCAGAGAGCTGCCTCTGCCCCGG + Intronic
970471538 4:16384366-16384388 GATTAGGGCTCCCTCTACCAAGG + Intergenic
970958671 4:21846745-21846767 GCCAAGGGCTCCACCTGTCCTGG + Intronic
971268710 4:25117322-25117344 TCCGAGGGCTCCCCCTGCCCTGG - Intergenic
974952919 4:68603750-68603772 GCCTAGGGCCCCCCATGCTCTGG + Intronic
978559885 4:110021964-110021986 TCCTGGGGCTCCTCCTGCCCAGG - Intergenic
983165940 4:164477458-164477480 GCAGTGGGCTCCCTCTCCCCAGG + Intergenic
984367863 4:178821518-178821540 AGCTAGGGCTCCCTCTGGGCTGG + Intergenic
985689588 5:1299693-1299715 CCCGAGGGCGCCATCTGCCCTGG - Intergenic
985764134 5:1768039-1768061 GCCCAGGGCTCCCTCAGCCCAGG - Intergenic
986336524 5:6759569-6759591 GGATATGGCGCCCTCTGCCCAGG + Intergenic
987856447 5:23425180-23425202 GCCTATGTCTCCCTCAGCCTAGG + Intergenic
988708949 5:33754397-33754419 GCCTAGGGCTCATCCTGCCCAGG - Intronic
990118970 5:52425563-52425585 GCTTAGGGCTCCCCATCCCCTGG + Intergenic
990340876 5:54821873-54821895 CCCTAAGGCTCACTTTGCCCAGG - Intergenic
991972824 5:72157517-72157539 GCCCATGGCTCCCTGTCCCCGGG - Intronic
992088894 5:73300823-73300845 GCCTAGGGCTCTCTTTGCCTGGG + Intergenic
992645674 5:78808828-78808850 CCCCTGGGCTCCCTCTGCTCGGG + Intronic
992792953 5:80230069-80230091 TCCTTGGGTTCCTTCTGCCCTGG - Intronic
994165709 5:96606187-96606209 GCCTGGGCCCCACTCTGCCCTGG - Intronic
996701832 5:126457725-126457747 CCCTAGTGTTCCCTCTGCCTGGG - Intronic
999240206 5:150123041-150123063 CCGTTGGGCTCCCCCTGCCCAGG - Exonic
999305383 5:150516011-150516033 ACCTTGCTCTCCCTCTGCCCTGG + Intronic
1001744997 5:174085768-174085790 ACCTAGGCCTTCCTCTGGCCTGG - Intronic
1002041946 5:176521081-176521103 GGCGTGTGCTCCCTCTGCCCAGG - Intergenic
1002066323 5:176653751-176653773 GGCTATGTCTGCCTCTGCCCTGG - Intronic
1002560710 5:180080173-180080195 GCCTCAGGCTTCCTCAGCCCAGG - Intergenic
1002708594 5:181180184-181180206 GCCCAGGGCTGCCTCTGTCCAGG + Intergenic
1003405113 6:5821472-5821494 TCCCAGGCTTCCCTCTGCCCAGG + Intergenic
1006225723 6:32535003-32535025 GCCTGGGGCTCCCTCTTGCCTGG - Intergenic
1006926461 6:37658179-37658201 CCCTGGGGCGCCCTCTGGCCCGG + Intronic
1006928576 6:37673507-37673529 GCCTGGGCCTCCTTCTGCCAGGG + Intronic
1007396592 6:41581449-41581471 GCCCAGGGCTCACACTGCCAGGG + Intronic
1011194949 6:84771961-84771983 GCCCAGGGCTCCCCCTGGCCAGG + Intergenic
1011344693 6:86356057-86356079 GCCAAGTGCTCACCCTGCCCTGG + Intergenic
1017805526 6:157942447-157942469 GCCTAGAGCCCCCTCTTTCCTGG - Intronic
1017916032 6:158832188-158832210 GCCTAGAGCTGTCTCTGCCAGGG + Intergenic
1018722826 6:166586823-166586845 GCTGTTGGCTCCCTCTGCCCTGG - Intronic
1018793537 6:167168901-167168923 CCCTGGGGGTCTCTCTGCCCAGG - Intronic
1018823178 6:167389477-167389499 CCCTGGGGGTCTCTCTGCCCAGG + Intergenic
1018918997 6:168157889-168157911 GCCCAGGGTCCCCCCTGCCCCGG + Intergenic
1019301443 7:306057-306079 GCCCTGGGCACCCTCTGGCCAGG + Intergenic
1019443907 7:1061082-1061104 GCACTGGGCTGCCTCTGCCCGGG + Intronic
1019558649 7:1645154-1645176 CCCCAGGGCTCCCTCACCCCAGG + Intergenic
1020092680 7:5350190-5350212 TCCGAGGCCTCCCCCTGCCCGGG - Intronic
1020262079 7:6536359-6536381 GTCCAGGGCTCCCGCTGCCCAGG + Intronic
1021694919 7:23267185-23267207 GCCTGGGGCTGCGTCTACCCAGG + Intronic
1022359125 7:29642398-29642420 GGCTGGGGCTCCCTCTCCCTTGG - Intergenic
1022496274 7:30854987-30855009 GCCTGGGGCTCCCGATGCCCCGG - Intronic
1026390077 7:69892022-69892044 GCCTTGTGATCCATCTGCCCTGG + Intronic
1028856074 7:95596080-95596102 GCCTAGCCCTCCCTCTACCAAGG + Intronic
1029088633 7:98031362-98031384 GCCCGGGGCTCACACTGCCCAGG - Intergenic
1029090218 7:98041916-98041938 GCCTAGGGCACCCTGACCCCAGG + Intergenic
1030065481 7:105655848-105655870 GGGGAGGGCTCCCTCTCCCCAGG - Intronic
1034198199 7:149263938-149263960 TTCTAGGGCCCCCTCTTCCCAGG - Intronic
1034494301 7:151410602-151410624 GCCGCGGGCTCCCTCGGCCTGGG + Intronic
1035232281 7:157472518-157472540 GGCACGGGCTCCCTCTCCCCAGG - Intergenic
1035360851 7:158313450-158313472 GCAGAGGGCTCCAGCTGCCCAGG + Intronic
1035630583 8:1104108-1104130 CCCCATGGCTCCCTCTGCCTTGG - Intergenic
1035654048 8:1292247-1292269 GTATTGGGTTCCCTCTGCCCTGG + Intergenic
1035741555 8:1931642-1931664 GCCTCCCCCTCCCTCTGCCCGGG - Intronic
1037626234 8:20609433-20609455 GCCTCGTGCTCACTCTGCCTGGG - Intergenic
1037782551 8:21880327-21880349 GCCTAGGCCTCCCAAAGCCCTGG - Intergenic
1037784869 8:21896554-21896576 ACCAAAGCCTCCCTCTGCCCTGG + Intergenic
1037933140 8:22895980-22896002 ACCTACTGCCCCCTCTGCCCTGG + Intronic
1039869459 8:41533343-41533365 GCCTGGGGCTCCAGCTGTCCTGG - Intronic
1040077155 8:43247430-43247452 GCCTAGGGCCCCCTCCCACCTGG - Intergenic
1041004915 8:53488268-53488290 CCCTACGTCTCCCTCAGCCCAGG + Intergenic
1041076668 8:54175634-54175656 CCCCAGGGCTCTCCCTGCCCAGG - Intergenic
1044006242 8:86940414-86940436 GCCTCGGCCTCCCTCGGCCTGGG + Intronic
1045010857 8:97957229-97957251 GTCCAGAGCTCCCCCTGCCCCGG - Intronic
1045017363 8:98010899-98010921 GCCTAGGCCTGCCTCAGCCCTGG - Intronic
1045385259 8:101666513-101666535 GCCTGGAGCTCCCCTTGCCCTGG + Intronic
1049352671 8:142172374-142172396 CCCCAGGGGTCCCTGTGCCCAGG + Intergenic
1049501983 8:142971781-142971803 GCCCAGTGCTCCCTCTGCTCTGG - Intergenic
1049510309 8:143024001-143024023 GCCCAGCTCTCCCTCTGCTCTGG + Intergenic
1050651960 9:7786037-7786059 GCCTATGTCTCCCTCGGCCTAGG - Intergenic
1051377917 9:16423081-16423103 GAGTAGGGCTTCCTCTGCCAGGG - Intronic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1055091226 9:72365801-72365823 GCCCAGGGCTGCCAATGCCCCGG + Intergenic
1055451344 9:76433700-76433722 GCCCAGGCTTCCCTCAGCCCAGG - Intronic
1057151303 9:92798466-92798488 GCCTGTGCATCCCTCTGCCCTGG - Intergenic
1057261268 9:93586154-93586176 GCCATGGGGTCCCTCTCCCCGGG - Intronic
1057718512 9:97514555-97514577 GACTAGAGCTCCCTCGCCCCTGG + Intronic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060294282 9:122332645-122332667 GCCCGGTGCTCCCTCCGCCCTGG + Intergenic
1061369004 9:130187444-130187466 GGCCAGGGCTGCCTCTGCCTGGG + Intronic
1061568968 9:131464297-131464319 TCCTAGGGCTCTTTCTACCCAGG + Intronic
1061658250 9:132109438-132109460 GTCTTGGCATCCCTCTGCCCAGG + Intergenic
1061801807 9:133116850-133116872 GCCTGGCGCTGCCTCTGCCATGG + Intronic
1062029487 9:134355822-134355844 GCCCTGGGCTCACCCTGCCCTGG + Intronic
1062043361 9:134414304-134414326 GTCTGGGGCTCCCCATGCCCTGG + Intronic
1062516759 9:136940720-136940742 GCCTTGGGCTCCATCTGCACTGG + Exonic
1062554329 9:137107148-137107170 GCCCAGCGCTGCCTCGGCCCTGG - Intronic
1189318730 X:40074388-40074410 GCCCAGGGTTCCCTCTGCCAAGG - Exonic
1193086069 X:77448455-77448477 GCCTTGGGGTCGCTCTGTCCAGG + Intronic
1193467833 X:81869056-81869078 GCCCAGGGCTCCCTCTCACCTGG + Intergenic
1194655225 X:96564939-96564961 GCCCAAGCCTCCCTCTCCCCAGG - Intergenic
1200404603 Y:2797026-2797048 GCTTAGTGCAACCTCTGCCCAGG - Intergenic