ID: 1059405215

View in Genome Browser
Species Human (GRCh38)
Location 9:114095031-114095053
Sequence GCGGGTCACCACCCGACCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059405215_1059405220 2 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405220 9:114095056-114095078 AGCTCGGCTTGCATATCGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1059405215_1059405221 18 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405221 9:114095072-114095094 CGCAGGGTGCTGAGAGTCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 176
1059405215_1059405219 1 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405219 9:114095055-114095077 GAGCTCGGCTTGCATATCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 29
1059405215_1059405223 28 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405223 9:114095082-114095104 TGAGAGTCTCAGGAAGGCACTGG 0: 1
1: 0
2: 3
3: 24
4: 266
1059405215_1059405224 29 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405224 9:114095083-114095105 GAGAGTCTCAGGAAGGCACTGGG 0: 1
1: 0
2: 0
3: 23
4: 262
1059405215_1059405222 22 Left 1059405215 9:114095031-114095053 CCTGTGGTCGGGTGGTGACCCGC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1059405222 9:114095076-114095098 GGGTGCTGAGAGTCTCAGGAAGG 0: 1
1: 0
2: 3
3: 26
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059405215 Original CRISPR GCGGGTCACCACCCGACCAC AGG (reversed) Exonic
914676911 1:149912957-149912979 GCAGACCACCACCCAACCACTGG + Intronic
1070643105 10:78182985-78183007 GCCAGTCACCTCCCTACCACCGG - Intergenic
1075563114 10:123482831-123482853 TCTGCTCACCACCCGCCCACTGG - Intergenic
1076637419 10:131891521-131891543 GCCGTTCTCCAGCCGACCACAGG + Intergenic
1084028077 11:66465446-66465468 GCAGGACACCACCAGACCGCTGG - Intronic
1084128885 11:67118783-67118805 GGGGGTCACCACCCTCCCAGGGG + Intergenic
1085100009 11:73792682-73792704 CCTGGTCACCACTAGACCACAGG + Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1113146771 13:107216596-107216618 GTGGGTCACCACCAGAAAACAGG - Intronic
1122111937 14:99509319-99509341 CCGGGTCACCGTCAGACCACTGG - Exonic
1132060149 15:98685764-98685786 GCGGCTCACCACTCCACCGCAGG + Intronic
1137820501 16:51440338-51440360 GCTGGGCATCACCCTACCACGGG - Intergenic
1140424384 16:74848648-74848670 GTGGGTCACCAGCACACCACAGG + Intergenic
1142217954 16:88839072-88839094 GCAGGTCACCACCCAGCCACAGG + Intronic
1142217964 16:88839117-88839139 GCAGGTCACCGCCCAACCACAGG + Intronic
1142217976 16:88839162-88839184 GCTGGTCACCGCCCGGCCACAGG + Intronic
1142217988 16:88839207-88839229 ACAGGTCACCGCCCGGCCACAGG + Intronic
1142218000 16:88839252-88839274 GCAGGTCACCGCCCGGCCACAGG + Intronic
1142218011 16:88839297-88839319 GCAGGTCACCGCCCGGCCACAGG + Intronic
1152758487 17:82097008-82097030 GCGGGCCCCCACCCCAACACGGG - Intronic
1158836152 18:61333725-61333747 GCGGGGCACCAGCCGCCCAGTGG + Exonic
1163442581 19:17329215-17329237 GCGCGTCTCCACCCCACCGCGGG + Intronic
1166141873 19:40809590-40809612 GCGGGCCTCCACCCTACCACAGG + Intronic
927040216 2:19222226-19222248 GCTGCTCACCACCTGACCATTGG + Intergenic
948315266 2:237023815-237023837 ACAGGTCCCCACCCCACCACAGG + Intergenic
1175808332 20:61843942-61843964 GGTGGTCACCAGCCCACCACAGG - Intronic
1183129785 22:35823035-35823057 GCTGGTCTCCACCTGACCTCAGG + Intronic
950459258 3:13111503-13111525 GCGGGTAAGCACCTGACCCCTGG + Intergenic
953972231 3:47356332-47356354 CCTGGTTACCTCCCGACCACTGG - Intergenic
954993914 3:54864802-54864824 GCCGGTGACCACCAGACCACAGG + Intronic
969431086 4:7154677-7154699 GCAGGTAACCACCCCACCCCTGG - Intergenic
1019339741 7:503400-503422 CCGGGTCACCCCCTGAGCACAGG + Intronic
1027138148 7:75639079-75639101 GCGGGGCACCCCCCCACCCCTGG + Intronic
1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG + Intronic
1039569207 8:38573662-38573684 GCTGGTCTCCACCCGAACATGGG - Intergenic
1049745466 8:144261346-144261368 GCGGGTGAGCACCCCTCCACGGG + Exonic
1059405215 9:114095031-114095053 GCGGGTCACCACCCGACCACAGG - Exonic
1191868099 X:65722151-65722173 GCAGGTGACCACTTGACCACAGG + Intronic
1192205955 X:69096353-69096375 GGTGGTCTCCACCCGGCCACTGG - Intergenic