ID: 1059405285

View in Genome Browser
Species Human (GRCh38)
Location 9:114095332-114095354
Sequence AACTCTTGCTCTCCCTCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059405285_1059405290 11 Left 1059405285 9:114095332-114095354 CCTGGGGAGGGAGAGCAAGAGTT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1059405290 9:114095366-114095388 ATCACTTGCCTAGGGCCATCAGG 0: 1
1: 0
2: 1
3: 30
4: 265
1059405285_1059405292 16 Left 1059405285 9:114095332-114095354 CCTGGGGAGGGAGAGCAAGAGTT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1059405292 9:114095371-114095393 TTGCCTAGGGCCATCAGGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 201
1059405285_1059405291 15 Left 1059405285 9:114095332-114095354 CCTGGGGAGGGAGAGCAAGAGTT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1059405291 9:114095370-114095392 CTTGCCTAGGGCCATCAGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 292
1059405285_1059405288 2 Left 1059405285 9:114095332-114095354 CCTGGGGAGGGAGAGCAAGAGTT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1059405288 9:114095357-114095379 GAAGGTTACATCACTTGCCTAGG 0: 1
1: 1
2: 2
3: 24
4: 245
1059405285_1059405289 3 Left 1059405285 9:114095332-114095354 CCTGGGGAGGGAGAGCAAGAGTT 0: 1
1: 0
2: 1
3: 33
4: 378
Right 1059405289 9:114095358-114095380 AAGGTTACATCACTTGCCTAGGG 0: 1
1: 1
2: 19
3: 234
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059405285 Original CRISPR AACTCTTGCTCTCCCTCCCC AGG (reversed) Exonic
900968608 1:5976756-5976778 GACTCTTGCCCTTCCTCCCATGG - Intronic
901384602 1:8899437-8899459 AAGTCTTGCTCTTCTCCCCCAGG + Intergenic
901661704 1:10802215-10802237 CCCTCTTGTTCTCCCTCCCCAGG - Intergenic
901788236 1:11638710-11638732 CCCTCCTGCTCTCCCTCCCCGGG + Intergenic
901918726 1:12520410-12520432 AAGTCTTGCTCTGTCTCCCAAGG - Intergenic
901953853 1:12770209-12770231 ACCACCTACTCTCCCTCCCCAGG + Intergenic
902673006 1:17987980-17988002 GCCGCCTGCTCTCCCTCCCCAGG - Intergenic
903769455 1:25754696-25754718 TCCTCTGGCTCCCCCTCCCCGGG + Intronic
905860778 1:41349790-41349812 GACTCTTGCTCTCCCTGCTGGGG + Intergenic
906515800 1:46438238-46438260 GACTCTGCCTCTGCCTCCCCAGG + Intergenic
907246323 1:53111307-53111329 AACTCTCCCTTTCCCTGCCCTGG - Intronic
907323277 1:53619093-53619115 ACCTCTGCCTCTCCCTCCTCTGG + Intronic
907748966 1:57243912-57243934 ATCTCTTGCTATTCCTCCCAGGG + Intronic
908743598 1:67354245-67354267 CACACCTGCTCTCCCTCACCTGG - Intronic
908993880 1:70128516-70128538 AACTCTTGTACTTCCTCCACAGG + Intronic
910025055 1:82639820-82639842 ACCTGATACTCTCCCTCCCCCGG - Intergenic
910490035 1:87758470-87758492 CACTCCATCTCTCCCTCCCCTGG + Intergenic
912843366 1:113058907-113058929 TTCTCTTTCTCTCCCTGCCCAGG + Intergenic
914909568 1:151773552-151773574 TACTCTTCCTCTCTCTCCACGGG + Exonic
916288921 1:163141959-163141981 AATCCTTTCTCTTCCTCCCCTGG - Intronic
916443165 1:164847222-164847244 TCCTCTTGCTCTTCCTCCCTGGG + Exonic
916445746 1:164870368-164870390 AAGTCTTGCTCTGTCTCCCCAGG + Intronic
917247251 1:173017255-173017277 AAGTCTTGCTCTTATTCCCCAGG - Intergenic
917834904 1:178933785-178933807 GACCCTTGCTCTCTCTCTCCTGG - Intergenic
919294460 1:195678204-195678226 AAGTCTTGCTCTTGCTGCCCAGG + Intergenic
919404820 1:197166053-197166075 TACTTATGCTATCCCTCCCCAGG - Intronic
919533193 1:198751475-198751497 CACTCTTTCTCACCCTCACCTGG + Intronic
919667109 1:200302649-200302671 AACTCAGGATTTCCCTCCCCCGG + Intergenic
919864679 1:201771471-201771493 AAGTCTTGCTCTTGTTCCCCAGG - Intronic
920750938 1:208676139-208676161 AAGTCTTGCTCTCGTCCCCCAGG - Intergenic
920877934 1:209854701-209854723 AACTCTTGCTCCCTCACCCCAGG - Exonic
921261539 1:213388910-213388932 AACTCTAGCTCTCACTGCCCAGG - Intergenic
921297992 1:213722633-213722655 CACTCTGGGTCTCCCTCCACTGG - Intergenic
921836666 1:219785431-219785453 ACATCCTTCTCTCCCTCCCCAGG + Intronic
922168039 1:223131887-223131909 CACTCTTTATCTCCGTCCCCTGG + Intronic
923551193 1:234965319-234965341 AGCTCTTGCCCTCCCTCCAGGGG + Intergenic
923634336 1:235680622-235680644 AAGTCTTGCTCTTGCTGCCCAGG + Intronic
924861611 1:247929428-247929450 ATCTCATTTTCTCCCTCCCCTGG + Intergenic
1064037442 10:11926246-11926268 AACGCTTCCTCTCCCTGCACTGG + Intronic
1065496112 10:26330027-26330049 TCCTCATGCTCTCCTTCCCCTGG - Intergenic
1066091996 10:32031971-32031993 AAGTCTTGCTCTTGTTCCCCAGG - Intronic
1068513411 10:57995251-57995273 TCCTGATGCTCTCCCTCCCCTGG - Intergenic
1069876321 10:71565389-71565411 AACTCTTTCTCTTCCTGCTCTGG + Intronic
1070206934 10:74273481-74273503 AAGTCTTGCTCTTGTTCCCCAGG + Intronic
1070961533 10:80503195-80503217 ACCGCTTCCTTTCCCTCCCCAGG - Intronic
1071349247 10:84722974-84722996 AAGTTTTGCTCTCCTTCCTCTGG - Intergenic
1072638920 10:97196340-97196362 CCCCCTTGCGCTCCCTCCCCCGG - Intronic
1073234942 10:102006309-102006331 AACTCTAGCTTTTCCTCCTCAGG - Intronic
1073455815 10:103636097-103636119 TACTCTTTCCCTCCCTCCTCTGG - Intronic
1073933732 10:108605474-108605496 TCCTAATGCTCTCCCTCCCCTGG + Intergenic
1074165022 10:110867497-110867519 ATCTCTTGTTCTCCATTCCCAGG + Intergenic
1074275257 10:111995529-111995551 AACACTTGCTCTACTTCCCAGGG - Intergenic
1074279371 10:112036591-112036613 GCCTCTTGCTCTCTCTCCACTGG + Intergenic
1074659715 10:115639950-115639972 TCCTAATGCTCTCCCTCCCCTGG + Intronic
1075335596 10:121606963-121606985 TGCTCTTGCTCTCCCTCTCCAGG + Intergenic
1075597944 10:123746006-123746028 ACCTCTGGCTCTCCCTACCTGGG + Exonic
1075870974 10:125772750-125772772 AACTCCTCCTCCCCCTCGCCAGG - Exonic
1078873569 11:15371774-15371796 AGCTTTGCCTCTCCCTCCCCTGG - Intergenic
1080749069 11:35136107-35136129 AGCTGTGCCTCTCCCTCCCCAGG - Intergenic
1081632740 11:44700825-44700847 AGGTCTGGCGCTCCCTCCCCTGG - Intergenic
1082048087 11:47747229-47747251 AACTCTCGCTCTTCTTGCCCAGG + Intronic
1083188509 11:61032700-61032722 AAGCCTTGCTCTCCAGCCCCTGG - Intergenic
1083512918 11:63228185-63228207 TCATCTTGCTCTGCCTCCCCTGG + Intronic
1083965590 11:66042101-66042123 TGCTCTTGCTCTCCCTCCCAGGG - Exonic
1085341454 11:75734167-75734189 AACTGTTGCTCTCACCCCTCTGG - Intergenic
1085473478 11:76773162-76773184 AATGCTTGCCCTCCCTCCCTGGG + Intergenic
1085587119 11:77719206-77719228 AGGTCTTGCTCTTACTCCCCAGG - Intronic
1087446638 11:98263147-98263169 AACTCTTGATCTGCCTGCCTCGG - Intergenic
1088385150 11:109246064-109246086 TCCTGATGCTCTCCCTCCCCCGG - Intergenic
1088923186 11:114276603-114276625 AATTCTTTCTCTCCCTCCCTGGG - Intronic
1089276960 11:117343654-117343676 AAGTCTTGCTCTCATTGCCCAGG + Intronic
1091230647 11:133985952-133985974 CATTCTTGCTCTTCCTTCCCAGG + Intergenic
1091286078 11:134409317-134409339 AAGTCATGCACCCCCTCCCCAGG - Intronic
1092394533 12:8114018-8114040 ATCTCTTGCTTTCCGTCCCAGGG - Intergenic
1092814029 12:12297365-12297387 AATTCTTTCTCTCTCTCTCCTGG - Intergenic
1094206501 12:27845727-27845749 CCCTGATGCTCTCCCTCCCCCGG + Intergenic
1094524452 12:31222564-31222586 AACTCACGCTCTTCCTCCCACGG - Intergenic
1094591743 12:31827809-31827831 AAGTCTTGCTCTCGTCCCCCAGG - Intergenic
1095153033 12:38818264-38818286 TCCTAATGCTCTCCCTCCCCTGG + Intronic
1096066368 12:48743905-48743927 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
1096078692 12:48819723-48819745 AGCGCTTCCTCTCCATCCCCAGG - Intronic
1096776193 12:53965876-53965898 GGCTGTTGCTCTCCCTCGCCCGG + Intergenic
1098245649 12:68514365-68514387 TCCTAATGCTCTCCCTCCCCCGG - Intergenic
1098671893 12:73241160-73241182 TCCTAATGCTCTCCCTCCCCTGG - Intergenic
1100698838 12:97124468-97124490 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
1101589625 12:106114108-106114130 AGCCCTTTCTCTCCCTTCCCAGG - Intronic
1101735611 12:107460681-107460703 AACTCTAGCTCTCCCTCAGAGGG + Intronic
1101861259 12:108484242-108484264 AACACTTCCCCTCTCTCCCCAGG + Intergenic
1102424171 12:112827760-112827782 TTCTAATGCTCTCCCTCCCCTGG - Intronic
1102545963 12:113655731-113655753 TGCTCTTTCCCTCCCTCCCCAGG - Intergenic
1103621140 12:122188023-122188045 ACCTCTTGTTCTCCTTCCCCGGG - Intronic
1103852243 12:123940802-123940824 GACTCTTGGCTTCCCTCCCCTGG - Intronic
1105211949 13:18262085-18262107 AACTGTGGCTCTCTCTCCCCAGG - Intergenic
1105636572 13:22221148-22221170 ACCTCTTGCGCTCCCTCTCTGGG + Intergenic
1106706581 13:32286719-32286741 GAGTCTTGCTCTGTCTCCCCAGG - Intronic
1108924961 13:55730988-55731010 TCCTAATGCTCTCCCTCCCCTGG + Intergenic
1108942002 13:55966950-55966972 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
1109689311 13:65865112-65865134 AAATCTTGCTCTTGTTCCCCAGG - Intergenic
1114672188 14:24417244-24417266 TCCTTTTGCTGTCCCTCCCCAGG + Exonic
1114975248 14:28088523-28088545 AATTCTCCCTCTTCCTCCCCAGG + Intergenic
1117229370 14:53699913-53699935 AATTCTTTCTCACCCTTCCCTGG + Intergenic
1117681078 14:58203274-58203296 AAGTCTTGCTCTTGCCCCCCAGG - Intronic
1117766895 14:59092949-59092971 AAATGTTACTCTCCCTTCCCTGG - Intergenic
1118197136 14:63637801-63637823 ATCCCTTGCCCCCCCTCCCCCGG - Intronic
1118945689 14:70384945-70384967 ATCTCTGCCTCTCCTTCCCCTGG + Intronic
1120151904 14:81045530-81045552 TCCTCATGCTCTCCCTCCCATGG + Intronic
1122306953 14:100772562-100772584 CACACCTGCTCTCCCTCCCAGGG - Intergenic
1122458864 14:101879158-101879180 CCCTCTTGCCCGCCCTCCCCCGG + Intronic
1122748947 14:103918787-103918809 ACCTCTTGATCTCCCTGCCTTGG - Intronic
1123121163 14:105917791-105917813 AACTCGAGCTCTTCCTCTCCTGG - Intergenic
1124635041 15:31359994-31360016 AGCTCTTGCTAGCCCTCCCTTGG + Intronic
1125004250 15:34799754-34799776 AACCGAGGCTCTCCCTCCCCCGG - Intergenic
1125127629 15:36242691-36242713 TCCTTATGCTCTCCCTCCCCTGG + Intergenic
1125321450 15:38493532-38493554 AACTCTTGGTCTCCTTTCCTTGG + Intronic
1125982961 15:44019709-44019731 GACTCTTGCTCTCATTGCCCAGG - Intronic
1126433892 15:48615933-48615955 AACTCTCTCTCTGCTTCCCCGGG - Intronic
1126771131 15:52057137-52057159 CACTCTTACTATCCCTCCCCCGG + Intronic
1128228586 15:66019497-66019519 CAATTTTGCCCTCCCTCCCCTGG + Intronic
1129885049 15:79031732-79031754 CCCTCGTGCTCTCTCTCCCCTGG - Intronic
1129951566 15:79596679-79596701 AAGCCTTGATCTCCCTCCCAGGG + Intergenic
1130257689 15:82333409-82333431 TCCTCCTGCTCTTCCTCCCCAGG + Intergenic
1130540323 15:84817282-84817304 ACCTGCTGCTGTCCCTCCCCTGG - Exonic
1131610292 15:93953795-93953817 AACTCTTGCTCTTGTCCCCCAGG - Intergenic
1131680034 15:94711855-94711877 TCCTCTTGCTCTCTCTCCTCTGG - Intergenic
1132358832 15:101194902-101194924 ATCTCATGCACTTCCTCCCCAGG + Intronic
1132436778 15:101812359-101812381 AATTCTTGTTCTCCCTTTCCAGG - Intronic
1132462431 16:62093-62115 AACTGCTGCAGTCCCTCCCCGGG + Intronic
1132815657 16:1825311-1825333 AACTGGTGCTCAGCCTCCCCTGG + Intronic
1133519453 16:6543002-6543024 TCCTCTCACTCTCCCTCCCCAGG + Intronic
1133694516 16:8248963-8248985 CATTTTTGCTCTCCCACCCCAGG - Intergenic
1134252491 16:12584048-12584070 TGCTCTTGCTCTTCCTCCTCAGG - Intergenic
1135420906 16:22304931-22304953 AACTCTTGCCCTGGTTCCCCTGG + Intronic
1138456226 16:57122287-57122309 GTCTCTTGCTCTCCTGCCCCAGG - Intronic
1138481009 16:57303468-57303490 ATCTCTTACCCTCCCTGCCCTGG - Intergenic
1140059645 16:71556925-71556947 AAGTCTTGCTCTCGTCCCCCAGG + Intronic
1140127487 16:72130434-72130456 AATCCTTGCTCTCCCACGCCTGG + Intronic
1140466903 16:75189886-75189908 AACAGTTGCTCTCCCTCACCTGG - Intergenic
1140506747 16:75478389-75478411 AACTCTTGCCCCTCCTCCTCTGG - Exonic
1140512380 16:75517412-75517434 AACTCTGGCTCTGCCCCCGCCGG - Intergenic
1140634009 16:76889171-76889193 TCCTCATGCTCTGCCTCCCCTGG - Intergenic
1141140869 16:81496019-81496041 CTCACTTGCTCTCCCTTCCCTGG - Intronic
1142150429 16:88510253-88510275 AACCCCAGCTCTCCCTCCCCAGG + Intronic
1142419533 16:89961892-89961914 CCTTCCTGCTCTCCCTCCCCAGG - Intronic
1142420216 16:89965531-89965553 ACCTGTTCCTATCCCTCCCCTGG - Intronic
1142483222 17:231160-231182 ATCTCTGTCTCTCCCTCCCCAGG + Intronic
1142485878 17:247402-247424 AACTCTGGCTCTGCCCTCCCTGG + Intronic
1142876108 17:2853085-2853107 AACACTGGCTCTCCCGGCCCTGG - Intronic
1143322208 17:6075645-6075667 AACTCAGAATCTCCCTCCCCAGG + Intronic
1143836355 17:9696038-9696060 AAATCTTCCTCTCCCTCTCTGGG + Intronic
1144784810 17:17825559-17825581 AACCCTGGCTCACTCTCCCCTGG + Intronic
1145306404 17:21677708-21677730 CCCTCTTGCTCTGTCTCCCCTGG - Intergenic
1146264520 17:31443535-31443557 TCCTCTTGCCCTCCCTCACCTGG + Intronic
1147132476 17:38417715-38417737 AAGTCTGTCCCTCCCTCCCCAGG + Intergenic
1147334017 17:39716163-39716185 AACTCTTCCTCTCCCTACATCGG + Intronic
1147649281 17:42052994-42053016 CACTTTGGCTCTCTCTCCCCTGG - Intronic
1148023652 17:44570149-44570171 AAGTCTCGCTCTCTTTCCCCAGG + Intergenic
1148132990 17:45273620-45273642 ACCTGTTCCTCTTCCTCCCCGGG - Intronic
1148669776 17:49402068-49402090 ACTTCCTGCTCTCCCTTCCCTGG + Intronic
1148833539 17:50452527-50452549 CCCTGATGCTCTCCCTCCCCCGG - Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1148863627 17:50617614-50617636 GACCCTTGCTCTCTCTCCCTGGG - Intronic
1149033559 17:52110168-52110190 AATGCTAGCTCTCCCTCCCCTGG + Intronic
1150344292 17:64392159-64392181 AAGTCTTGCTCTGTCACCCCAGG - Intronic
1150875038 17:68961472-68961494 AGCTGTTGCTCTGTCTCCCCGGG - Intergenic
1151353021 17:73542739-73542761 GACACTTGGTCTCCCTCCCTGGG + Intronic
1152566991 17:81104847-81104869 CACGCTTGCTCTCACTGCCCAGG - Intronic
1153151156 18:2095055-2095077 ATCTCTTTCTCTCCCTGCCAAGG - Intergenic
1153309400 18:3663243-3663265 GAGTCTTGCTCTCCTTGCCCAGG - Intronic
1155154748 18:23148913-23148935 GAGTCTTGCTCTCTCTGCCCAGG + Intronic
1155288904 18:24321000-24321022 AAGTCTTGCTCTTGTTCCCCAGG - Intronic
1155538256 18:26840286-26840308 AACACTTTCACTCCCTCCCAAGG + Intergenic
1159599304 18:70413496-70413518 GACTCTTGCTCTGTCACCCCAGG - Intergenic
1160028560 18:75239090-75239112 CACTCTTGCTCTTCCTGGCCAGG - Intronic
1160590841 18:79943960-79943982 AACTCCTGGGCTCCTTCCCCGGG - Intronic
1162149352 19:8633763-8633785 ACATCTGTCTCTCCCTCCCCAGG - Intergenic
1162586824 19:11564842-11564864 AAATCTTGCCTTCCCTCCACAGG + Intronic
1162921879 19:13908029-13908051 GAGTCTTGCTCTCTCGCCCCAGG + Intronic
1163482869 19:17568487-17568509 AACTCTCGCTCTCTCCCCACAGG + Exonic
1164068481 19:21742994-21743016 ACCTCTTGATCTGCCTGCCCCGG - Intronic
1164102209 19:22066525-22066547 CACTCCTGCTTGCCCTCCCCTGG - Intronic
1164286949 19:23825610-23825632 GACTCTTGCTCTTCTTGCCCAGG + Intronic
1166338260 19:42121969-42121991 CACTCTTGGGCTCCCACCCCAGG - Intronic
1166708805 19:44924204-44924226 ATCTCTTTCTCTCCATCCCTGGG - Intergenic
1167761843 19:51454649-51454671 AGGTCTCTCTCTCCCTCCCCAGG + Intronic
1167855943 19:52240019-52240041 AAGTCTTGCTCTTGTTCCCCAGG + Intergenic
1168214179 19:54913133-54913155 ACCTCTAGCTCTCCATCCCTCGG + Intronic
925425826 2:3748074-3748096 AGCTCCTGCCCTCCCTCACCAGG - Intronic
925468703 2:4135700-4135722 ACCTCTCCCTCTCCCTCCACGGG - Intergenic
925702380 2:6651629-6651651 AAGTCTTGCTCTTGTTCCCCAGG + Intergenic
926516225 2:13850380-13850402 CACTCATGCTCTGCCTCCTCCGG - Intergenic
929261823 2:39874723-39874745 AAGTCTTGCTCTTGGTCCCCAGG + Intergenic
930026716 2:47033663-47033685 GACACCTGCTCTCTCTCCCCTGG + Intronic
932804866 2:74774787-74774809 TCCTAATGCTCTCCCTCCCCTGG + Intergenic
933672433 2:85021840-85021862 AAATCTTGCTCTTGTTCCCCAGG + Intronic
933902986 2:86862352-86862374 AAGTCTTGCCCTCCCTTGCCAGG + Intergenic
934301678 2:91780388-91780410 AACTGTGGCTCTCTCTCCCCAGG + Intergenic
934517102 2:94995552-94995574 AACCCATGGTCTACCTCCCCTGG + Intergenic
935665544 2:105508985-105509007 CACTCTGGTTTTCCCTCCCCAGG - Intergenic
935764046 2:106347106-106347128 AAGTCTTGCTCTTCTCCCCCAGG + Intergenic
935777559 2:106486918-106486940 AAGTCTTGCCCTCCCTTGCCAGG - Intergenic
935946327 2:108289747-108289769 AAGTCCTTCTCACCCTCCCCAGG - Intronic
935981832 2:108635400-108635422 AAGTCTTGCTCTTTCCCCCCAGG - Intronic
936347820 2:111688545-111688567 AACTCTTGCTGTCACACCTCGGG + Intergenic
936408222 2:112227498-112227520 AAGTCTTGCTCTTCTCCCCCAGG - Intronic
937244987 2:120486757-120486779 TTCTCTTGCTCTCCTTCCCTGGG + Intergenic
937636144 2:124157228-124157250 AACTCATGGTCTCTCTACCCAGG - Intronic
937860991 2:126709035-126709057 AACTCTGGGTCTCCCTTGCCAGG - Intergenic
938670157 2:133578678-133578700 AATTCTTCCCCTCCCTCCCATGG + Intergenic
941384772 2:164840787-164840809 AACTTTTGCCCTCCCTCCCCAGG + Intronic
941757106 2:169198592-169198614 AACTCTTTCTCTCTGTTCCCTGG - Intronic
943887548 2:193241154-193241176 TACTCTTCTCCTCCCTCCCCTGG + Intergenic
945043841 2:205764674-205764696 TTCTCATGCTCGCCCTCCCCAGG - Intronic
945074429 2:206023448-206023470 ACCTCGTGATCTGCCTCCCCCGG - Intronic
945888763 2:215406259-215406281 GAGGCTTGCTCTCCCTCCCATGG + Exonic
946212759 2:218160853-218160875 ACCCCTTGCCCTCCATCCCCTGG - Intergenic
946398192 2:219453941-219453963 AACTGCTGGACTCCCTCCCCTGG - Intronic
947706638 2:232281729-232281751 AATGCCTGCTCTTCCTCCCCTGG - Intronic
948036734 2:234863815-234863837 GACTCTGGCCCTCCTTCCCCAGG - Intergenic
948283699 2:236768389-236768411 CACTCTTTCTTTGCCTCCCCAGG + Intergenic
948377791 2:237533201-237533223 AACTCTAGCTCCCACTCCCCAGG - Intronic
948532162 2:238615977-238615999 ATCTCTCGCCCTTCCTCCCCAGG + Intergenic
948580895 2:238986611-238986633 AAGGCTCGCTCTCGCTCCCCTGG + Intergenic
948781045 2:240322043-240322065 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
948850296 2:240702369-240702391 GACCCTTCCTCTCCCTCCCTAGG + Intergenic
1170731030 20:18974880-18974902 TTCTCCTGCTCTCTCTCCCCAGG - Intergenic
1171365622 20:24621607-24621629 AAATCTTTCTGTCCCTTCCCAGG - Intronic
1171451986 20:25242287-25242309 AACTGATGCCCTCCCTCCACTGG - Intergenic
1172042335 20:32054194-32054216 TCCTGTTTCTCTCCCTCCCCAGG + Intronic
1172426831 20:34861334-34861356 AACTCTTTTTCCCACTCCCCTGG + Intronic
1172507355 20:35473352-35473374 TTCTCTTGCTCTCTCTCCACAGG + Exonic
1172587116 20:36092669-36092691 CGCTCCTGCTCTCCCTCCCACGG - Intronic
1173210839 20:41029812-41029834 GTCTCTTTCTCTCCCTCCCTCGG + Intronic
1173447728 20:43135037-43135059 CAGTTTTGCACTCCCTCCCCAGG - Intronic
1173474305 20:43348053-43348075 GACTCTTGCTCTGTCACCCCAGG - Intergenic
1173844678 20:46180418-46180440 AACTCTAGCTCTCCCCCCAAAGG + Intronic
1174669305 20:52291673-52291695 AACTGCTTCTCTCCTTCCCCAGG + Intergenic
1174899576 20:54484351-54484373 AAGTCTTGCTCTTTTTCCCCAGG - Intronic
1175392153 20:58634352-58634374 AAATCTTGCTTGCCTTCCCCAGG + Intergenic
1175413206 20:58784985-58785007 ACCTCTTTCTCTTCCTGCCCTGG - Intergenic
1175734565 20:61376351-61376373 TCCTCTTGCCCTCCTTCCCCTGG - Intronic
1177384671 21:20393224-20393246 TACTAATGCTCTCCCTCCCCTGG + Intergenic
1177585225 21:23084451-23084473 TTCTCTTCCTCTCCCTCCTCTGG - Intergenic
1179075028 21:38113006-38113028 GAGTCTTGCTCTCACTGCCCAGG - Intronic
1179626533 21:42652649-42652671 GTCACTTCCTCTCCCTCCCCTGG - Intergenic
1179973014 21:44846790-44846812 ATCTGTGGCTCTGCCTCCCCAGG - Intergenic
1180231763 21:46430621-46430643 CACTCTGGCTCTCCCTCTGCAGG - Exonic
1180701555 22:17784107-17784129 AATTCTTCCTGTCCTTCCCCTGG - Intergenic
1180814756 22:18782331-18782353 AACTGTGGCTCTCTCTCCCCAGG - Intergenic
1181200943 22:21216667-21216689 AACTGTGGCTCTCTCTCCCCAGG - Exonic
1181553467 22:23654036-23654058 AGCCCTGGCTCTCCCTCCCCGGG - Intergenic
1181700798 22:24620306-24620328 AACTATGGCTCTCTCTCCCCAGG + Exonic
1181811987 22:25408888-25408910 GAGTCTTGCTCTCTCTCCCAGGG - Intergenic
1182348982 22:29687890-29687912 AACTCTTCCTCTCCGCCTCCTGG + Intronic
1183029561 22:35093348-35093370 GAGTCCTGCTCTCCCTCCTCTGG - Intergenic
1183187052 22:36298183-36298205 AGGTTTTGGTCTCCCTCCCCTGG + Intronic
1183242401 22:36667687-36667709 AAATGTAGCTTTCCCTCCCCAGG - Intronic
1183480107 22:38059115-38059137 AGCTTTTTCTCTCCCTCCCTTGG - Intronic
1183846465 22:40545454-40545476 AAGTCTTGCTCTTGTTCCCCAGG + Intronic
1184298585 22:43541796-43541818 ATCTCTCCCCCTCCCTCCCCTGG + Intronic
1184734562 22:46390486-46390508 CACACCTGCTCTCCTTCCCCAGG - Exonic
1203225974 22_KI270731v1_random:78768-78790 AACTGTGGCTCTCTCTCCCCAGG + Intergenic
1203264853 22_KI270734v1_random:8018-8040 AACTGTGGCTCTCTCTCCCCAGG - Intergenic
950754422 3:15161419-15161441 CACTGTTGTTCACCCTCCCCTGG - Intergenic
951593918 3:24296705-24296727 AACTCCTGATCACCCTCCACAGG - Intronic
952745206 3:36770537-36770559 ATCTCTTTCCTTCCCTCCCCAGG + Intergenic
955350834 3:58191890-58191912 ACCCCATGCTCTCCCTCCCTGGG - Intergenic
961138433 3:124534385-124534407 TCCTAATGCTCTCCCTCCCCTGG - Intronic
961621992 3:128231600-128231622 AACTCAGGCTGGCCCTCCCCAGG + Intronic
961622962 3:128239236-128239258 TACTCTTCCTCTTCCTCCTCTGG + Intronic
961856450 3:129876106-129876128 AAATCTTGCTCTTGTTCCCCAGG - Intronic
964167831 3:153730132-153730154 AATTCTTGATCTCCCTTCTCAGG - Intergenic
964794189 3:160479862-160479884 GAGTTTTGCTCTTCCTCCCCAGG - Intronic
965890048 3:173501238-173501260 TCCTGATGCTCTCCCTCCCCCGG + Intronic
966554585 3:181244650-181244672 AGCTCTTTCTATCCCTCCCCAGG - Intergenic
966795064 3:183705804-183705826 AACTCGTGATCTGCCTGCCCCGG - Intronic
967370149 3:188735405-188735427 AAGTCTTGCTCTCATCCCCCAGG + Intronic
967890602 3:194361739-194361761 AGCTCTTCCTCACCCTCGCCTGG + Intronic
967952216 3:194850088-194850110 CACTCCTTCACTCCCTCCCCGGG - Intergenic
968403937 4:323159-323181 AAGTCTTGCTCTCGTCCCCCAGG + Intergenic
968930717 4:3577156-3577178 AACACCTGCTCTCCCTCCCTGGG - Intronic
969152946 4:5186031-5186053 AACTCCTGCTCATCCTCCACAGG + Intronic
970447958 4:16139775-16139797 ATCTCTTCATCTCCCGCCCCAGG - Intergenic
972537131 4:40009094-40009116 AAGTCTTGCTCTTGTTCCCCAGG + Intergenic
972635292 4:40878571-40878593 AACTCATCCTCTCCCGCCTCAGG + Intronic
973586921 4:52402373-52402395 AACCCCTCCTCTCCCTTCCCTGG + Intergenic
974684252 4:65204925-65204947 AAGTTTTGCTCTCCTTGCCCAGG + Intergenic
977876980 4:102161887-102161909 AGCTCTTGCTGTCCCTCATCAGG - Intergenic
978173655 4:105704427-105704449 AACTCTTGGTCTCCATTCCTAGG + Intronic
978436596 4:108692319-108692341 TACTATTGCTCTCCCTCGTCTGG + Intergenic
978616368 4:110600669-110600691 ACCTCTTGCTCTGCCTGCCTCGG - Intergenic
979005630 4:115292358-115292380 ACCACTTCCTCTCCCTGCCCTGG - Intergenic
980064891 4:128176317-128176339 AAGTCTTGCTCTTGTTCCCCAGG + Intronic
981176161 4:141686267-141686289 AACTCTTGCTCTTGTTGCCCAGG - Intronic
981474307 4:145173156-145173178 ACCTCATGCTCTGCCTGCCCCGG - Intronic
982225416 4:153161012-153161034 TAGTCTTCCTCTCCCTCCCAGGG - Intronic
982671169 4:158321214-158321236 AGCTCTTGCTCCTCCTCCACTGG + Intronic
984507245 4:180635290-180635312 CACTTTTGCTTTCCCTCCTCCGG + Intergenic
984702508 4:182827314-182827336 AGCTCTTCCTTTCCCTCCGCAGG - Intergenic
985570752 5:643571-643593 GACTCAGGCGCTCCCTCCCCTGG + Intronic
986181231 5:5394763-5394785 ACCTCTTGCTGTCCCCCACCTGG + Intergenic
986311852 5:6557029-6557051 AGCTCTTGCTCTTCTTCTCCTGG - Intergenic
987262395 5:16216451-16216473 AACTCGTGATCTGCCTCCCTCGG - Intergenic
987706892 5:21469745-21469767 ACCTCTTGCTGTCCCCCACCTGG - Intergenic
987960113 5:24796520-24796542 GAGTCTTGCTCTGTCTCCCCAGG + Intergenic
989618474 5:43360963-43360985 TCCTCATGCTCTCCCTCCCCTGG + Intergenic
989766008 5:45084529-45084551 TCCTATTGCTATCCCTCCCCTGG + Intergenic
990379245 5:55205834-55205856 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
990899814 5:60738310-60738332 CTGTCTTGCTCTGCCTCCCCAGG - Intergenic
992384462 5:76270417-76270439 TACTCTTGTTTTTCCTCCCCTGG - Intronic
996938892 5:128980082-128980104 ATCTGTTGCTCTCCCTTCCAGGG + Intronic
997342014 5:133152363-133152385 AAGTCTTGCTCTGCCACCCAGGG - Intergenic
998151035 5:139757596-139757618 ATCTCTTTCTCTCCCTCTCAAGG - Intergenic
998583296 5:143403004-143403026 GCCTCTTCCTCTCCCTCCGCAGG - Intronic
999429117 5:151510904-151510926 AACTCTCCCTGTCCCTCACCAGG - Intronic
999754935 5:154657217-154657239 AAGTCTTGCTCTTGTTCCCCAGG - Intergenic
1001381992 5:171311361-171311383 TACTGTCCCTCTCCCTCCCCCGG + Intronic
1003555691 6:7137783-7137805 TCCTCTTCCTCTCCCTGCCCTGG + Intronic
1004019884 6:11767896-11767918 AATTCGTCATCTCCCTCCCCAGG + Intronic
1004799737 6:19133211-19133233 ATCTGTTTCTCTCCCTCACCAGG + Intergenic
1005886027 6:30098390-30098412 GGCTCTTACTCTCCCTCCCTAGG + Intergenic
1006060428 6:31414645-31414667 GACCCTTGCTCTCAGTCCCCAGG - Intronic
1006072872 6:31509417-31509439 GACCCTTGCTCTCAGTCCCCAGG - Intronic
1006671426 6:35731906-35731928 AACTCTTTCTCTCCCGCGCTCGG - Intergenic
1006894318 6:37457240-37457262 AGCTTTCGCTCTCTCTCCCCAGG - Intronic
1007793590 6:44329034-44329056 ACCTCTTGCTCTGCCACCCCTGG - Intronic
1007835166 6:44668371-44668393 AAGTCTTGGTCTCTTTCCCCAGG - Intergenic
1009021330 6:57950754-57950776 ACCTCTTGCTGTCCCCCACCTGG + Intergenic
1011626250 6:89285948-89285970 GACTCCTCCTCTCCCTCCCAAGG + Intronic
1013532521 6:111033309-111033331 AAGTCTTGCTCTGTCACCCCAGG + Intergenic
1014421579 6:121252581-121252603 TCCTAATGCTCTCCCTCCCCTGG - Intronic
1015794481 6:136997445-136997467 GACTCTTGCTCTGTCACCCCAGG + Intergenic
1015885188 6:137910627-137910649 ATCTCTTTCCCACCCTCCCCTGG - Intergenic
1016312055 6:142744730-142744752 ACCTCTTGCTATCCCTTTCCTGG + Intergenic
1017722015 6:157249952-157249974 CGCTCGTGCTCTGCCTCCCCAGG - Intergenic
1018738960 6:166712902-166712924 ATGTCTCGCTCTCTCTCCCCTGG + Intronic
1019379615 7:714000-714022 ACCTCTGGCTCTCCCAGCCCTGG + Intronic
1019564707 7:1673568-1673590 ACCTCCCGCCCTCCCTCCCCAGG - Intergenic
1020321443 7:6941457-6941479 AACTCTGGCTCTCTCCCGCCAGG - Intergenic
1023220746 7:37918445-37918467 AGCTCTTTCTCTTGCTCCCCAGG - Intronic
1024929391 7:54654046-54654068 ACCTCATGGTGTCCCTCCCCTGG + Intergenic
1025284346 7:57650118-57650140 CCCTCTTGCTCTGCCTCCCCTGG - Intergenic
1025835439 7:65089008-65089030 ATCTCTTGATCTACCTGCCCCGG + Intergenic
1026018398 7:66689774-66689796 AAGTCTTGCTCTCATCCCCCAGG - Intronic
1026837256 7:73647368-73647390 CCCTCTGGCTCTCCCTGCCCTGG - Intergenic
1027486396 7:78767013-78767035 GAGTCTTGCTCTCCTTGCCCAGG + Intronic
1027572572 7:79888800-79888822 AATTCTTGTTCTCCCTCTGCAGG + Intergenic
1029221348 7:98993218-98993240 AACTCTTGTGCGCCCTCACCTGG + Intronic
1029792476 7:102859569-102859591 CACTCTTCCTGTCCCTCCCAGGG - Intronic
1030019350 7:105257876-105257898 ACCTCTTGCTCTGCCTGCCTCGG - Intronic
1030193584 7:106832483-106832505 AACTCTTTCACATCCTCCCCTGG + Intergenic
1030532648 7:110729770-110729792 TCCTGATGCTCTCCCTCCCCCGG - Intronic
1031725874 7:125237492-125237514 AAGTCTTGCTCTTGTTCCCCTGG - Intergenic
1033168716 7:139064674-139064696 AACACTTGCTCTGCCACCCTAGG - Intronic
1033451599 7:141466959-141466981 TCCTCTTACTCTCCCACCCCAGG + Intronic
1033889802 7:145997589-145997611 TACTCTTGCTCTGCTTCTCCAGG - Intergenic
1034475338 7:151278228-151278250 AAGTCTTGCTCTCGTCCCCCAGG + Intergenic
1035406106 7:158598481-158598503 AAGTCTTGCTCTGTCACCCCAGG - Intergenic
1035664434 8:1370329-1370351 AACCCTTGCTCTCCCTGGGCAGG + Intergenic
1036239159 8:7068060-7068082 ATCTTATGCTCTCCCTCCCAGGG + Intergenic
1036583473 8:10100269-10100291 GACTCTGCCTCTCCCTCTCCTGG - Intronic
1036820595 8:11936493-11936515 ATCTTATGCTCTCCCTCCCAGGG - Intergenic
1036906660 8:12713147-12713169 ATCTTATGCTCTCCCTCCCAGGG - Intergenic
1037305042 8:17496497-17496519 AACTTCTGCTCTTGCTCCCCTGG + Intergenic
1037561844 8:20082406-20082428 AAGTCTTGCTCTGTCTCCCAGGG - Intergenic
1037948748 8:23005350-23005372 CACTCTTCCTCCCCGTCCCCAGG + Exonic
1037985638 8:23288994-23289016 ACTTCTTCCCCTCCCTCCCCAGG + Exonic
1038856376 8:31337450-31337472 TCCTAATGCTCTCCCTCCCCTGG - Intergenic
1039234070 8:35482826-35482848 AAGTCTTGCTCTCGTCCCCCAGG + Intronic
1040860451 8:51993575-51993597 TCCTGATGCTCTCCCTCCCCCGG - Intergenic
1041129407 8:54681670-54681692 TCCTGATGCTCTCCCTCCCCTGG + Intergenic
1042799628 8:72704767-72704789 AACCCTCCCTCTCCCTCCACAGG + Intronic
1042936121 8:74060118-74060140 AGGTCTGGCTCTCCCTCCCAGGG - Intergenic
1043268600 8:78300071-78300093 TCCTAATGCTCTCCCTCCCCTGG - Intergenic
1044297387 8:90544862-90544884 AACTCTTCCTCCACTTCCCCAGG + Intergenic
1044983524 8:97738657-97738679 AACTCTCGCTCTCGTACCCCAGG + Intergenic
1045497712 8:102722272-102722294 AAAACTTGCTTTCCCTTCCCTGG + Intergenic
1045648616 8:104322995-104323017 CACTCTTTCTCTCCATCCCTGGG + Intergenic
1045960288 8:107959384-107959406 ACTTCCTCCTCTCCCTCCCCTGG - Intronic
1047961108 8:130012472-130012494 TGCTCTTTCTGTCCCTCCCCTGG - Intronic
1048216672 8:132501949-132501971 CATCCTTGCTCTCCCTCCCTTGG + Intergenic
1049858464 8:144880038-144880060 AAGTCTTGCTCTTGTTCCCCAGG - Exonic
1051876838 9:21802597-21802619 GACTCCTCCTCTTCCTCCCCGGG - Exonic
1052288515 9:26815717-26815739 AAATCTTGCTCTTGTTCCCCAGG - Intergenic
1052765522 9:32636030-32636052 AAGTCTTGCTCTGTCGCCCCAGG + Intergenic
1053328808 9:37184428-37184450 ACCTCTTGCTCTCCCAGCTCTGG - Intronic
1054459402 9:65454758-65454780 AACACCTGCTCTCCCTCCCTGGG + Intergenic
1054991941 9:71337944-71337966 TCCTAATGCTCTCCCTCCCCTGG - Intronic
1055596653 9:77872381-77872403 AACTGTGGCTTTCCCTTCCCTGG + Intronic
1056660650 9:88540673-88540695 CACTTTTCCTTTCCCTCCCCAGG + Intronic
1057024898 9:91727433-91727455 AACTCTTTGTCTCCCTCTACAGG + Intronic
1059405285 9:114095332-114095354 AACTCTTGCTCTCCCTCCCCAGG - Exonic
1059988495 9:119842366-119842388 TGCTCTTGCTCTCCCACCCCAGG - Intergenic
1060198067 9:121635927-121635949 GAGTCTTGCTCTGTCTCCCCAGG + Intronic
1060203408 9:121666609-121666631 TCCTCATGCTCTCCCTCCCCTGG - Intronic
1060245229 9:121940287-121940309 AACTCTCTCTCTCCCTCCCTTGG + Intronic
1060933358 9:127502752-127502774 TGCTCCCGCTCTCCCTCCCCAGG + Exonic
1061098644 9:128474936-128474958 AAGTCTTGCTCTTGTTCCCCAGG - Intronic
1061425946 9:130498494-130498516 CACTCTTGCTCTTCCTTCCTTGG + Intronic
1061876941 9:133548771-133548793 AACTGTTGCGCACCCACCCCAGG + Intronic
1185601991 X:1346411-1346433 AAGTCTTGCTCTCGTCCCCCAGG - Intronic
1187188987 X:17014783-17014805 AAGTCTTGCTCTCTCTTTCCTGG + Intronic
1187582004 X:20617084-20617106 AACTCCCTCTCTCTCTCCCCTGG - Intergenic
1187669738 X:21656827-21656849 AACTCTTCCTCTTCTTCCTCGGG + Exonic
1190499386 X:51059951-51059973 CCCCATTGCTCTCCCTCCCCAGG + Intergenic
1194820666 X:98502600-98502622 AAGTCTTGTTCTTCTTCCCCAGG - Intergenic
1196161130 X:112484029-112484051 TCCTGATGCTCTCCCTCCCCTGG + Intergenic
1196476047 X:116088332-116088354 TCCTAATGCTCTCCCTCCCCAGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1199291289 X:146107373-146107395 CACTCTTTCACTGCCTCCCCCGG + Intergenic
1199563598 X:149190584-149190606 TCCTGATGCTCTCCCTCCCCTGG + Intergenic
1200308049 X:155048274-155048296 GCCTCCTGCTCTCACTCCCCTGG - Intronic
1201267006 Y:12216884-12216906 CACACTTGCTTTTCCTCCCCTGG + Intergenic