ID: 1059415753

View in Genome Browser
Species Human (GRCh38)
Location 9:114161626-114161648
Sequence GGGCTAAGGCTGGGACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059415753_1059415763 27 Left 1059415753 9:114161626-114161648 CCTGTCTGTCCCAGCCTTAGCCC 0: 1
1: 0
2: 2
3: 21
4: 272
Right 1059415763 9:114161676-114161698 GCCTGTGTCCCGCCTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059415753 Original CRISPR GGGCTAAGGCTGGGACAGAC AGG (reversed) Intronic
900637364 1:3672571-3672593 GGTCCAGGGCTGGGACAGAGCGG - Intronic
900759293 1:4460360-4460382 AGGATGAGGCTGGGACAGGCTGG - Intergenic
902279064 1:15361238-15361260 GGGCTGAGGCTGGGATACCCTGG - Intronic
902398314 1:16144213-16144235 GAGCTGAGGGTGGGGCAGACAGG + Intronic
903357549 1:22757297-22757319 AGGATAAGGCAGGCACAGACAGG + Intronic
904300251 1:29549502-29549524 GGGCGAGGGCTGGGCCACACAGG - Intergenic
904457984 1:30658613-30658635 GGGCAAGGGCTGGGCCACACAGG + Intergenic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
905168286 1:36096373-36096395 AGGCTAAGGCTGGGAGAGAAAGG - Exonic
905653904 1:39673620-39673642 GAGCTGGGGCTGGGACAGCCAGG - Intergenic
906027913 1:42690648-42690670 GGGCTAAAGCTGGGGCAATCAGG - Intronic
906113119 1:43337818-43337840 GGGCTAAGGCAGGCACACAGTGG + Exonic
906730962 1:48080717-48080739 GGGCTAAGGGTGGGACTGCCTGG - Intergenic
907710553 1:56876649-56876671 GGGCTCAGGGTGAGACAGAGAGG + Intronic
909274300 1:73665476-73665498 AGGCTGAGGCTGGTACAGTCTGG + Intergenic
910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG + Intergenic
911525100 1:98974867-98974889 GCTCTAAGGCTGGGACTGTCTGG + Intronic
911668768 1:100585065-100585087 GGTATAAGATTGGGACAGACAGG - Intergenic
913335749 1:117707985-117708007 GGCCTTAGCCTGGGACAAACGGG - Intergenic
913354552 1:117904709-117904731 GGACTAATGCTGAGACAGCCAGG - Intronic
913957557 1:143319009-143319031 GGGCCCAGGCTGGGACACGCAGG + Intergenic
914051868 1:144144373-144144395 GGGCCCAGGCTGGGACACGCAGG + Intergenic
914127329 1:144822168-144822190 GGGCCCAGGCTGGGACACGCAGG - Intergenic
914792140 1:150887533-150887555 GGTCTTGGGCTGAGACAGACGGG - Intergenic
915280471 1:154818922-154818944 GGGGCAAGGCTGGGGAAGACGGG + Intronic
915489878 1:156245043-156245065 GGGCTGAGGCAGGGACTGAGGGG + Intronic
916179573 1:162071615-162071637 TGGGTATGGCTGGGACAGAGTGG + Intronic
916397830 1:164411438-164411460 GGGCAAAGGCTGGAAGAGTCTGG + Intergenic
916727206 1:167533801-167533823 GGGCTAATGCTGAGACTCACAGG - Intronic
917057388 1:170997910-170997932 TGGCAAAGGATGGGAGAGACAGG + Intronic
920068279 1:203284587-203284609 GAGCTGGGGCTGGGACTGACGGG + Intergenic
920217516 1:204371499-204371521 TTGCAAAGGCAGGGACAGACAGG + Intronic
920244932 1:204580330-204580352 GGGCCAGGGCTGGGGCAGAAGGG - Intergenic
920498780 1:206473338-206473360 GGGCCAAGGCTGGGCTGGACAGG - Intronic
921641116 1:217555903-217555925 AGACTAAGGCTGAGACATACAGG + Intronic
922485881 1:225972669-225972691 GGGATAGGGCTGGGCCTGACCGG + Intergenic
922496730 1:226062992-226063014 GGGCTGAGGCGGCGAGAGACGGG - Intronic
922801237 1:228365650-228365672 GGGGCAGGGCTGGGACAGGCTGG - Intronic
923690288 1:236185925-236185947 GGGGTAGGGCAGGGACAGAAAGG - Intronic
1063573331 10:7237579-7237601 GGGCTAGGGGTGGGAGAGAATGG + Intronic
1066043598 10:31577842-31577864 GGGCTCAGGCTGGAGAAGACAGG - Intergenic
1066308054 10:34166514-34166536 AGGCTAAGGCGGGGGCAGGCAGG + Intronic
1066760112 10:38741574-38741596 GGGCCCTGGCTGGGACACACAGG - Intergenic
1066961501 10:42231194-42231216 GGGCCCAGACTGGGACACACAGG + Intergenic
1069943908 10:71973173-71973195 GGGCCAAGGAAGGGACAGACAGG + Intronic
1070312911 10:75286788-75286810 GGGCCAGGGCTGAGACAGAGGGG + Intergenic
1070560539 10:77563531-77563553 GGGCTAGGGCTGGGAGGGACGGG - Intronic
1070671860 10:78383163-78383185 GGTGTGAGGCTGGGACAGAGGGG - Intergenic
1072664144 10:97381639-97381661 GGGCCAGTGCTGGGAAAGACAGG + Intronic
1073096684 10:100984275-100984297 GGGCTTTGGCTGGGCCTGACTGG - Exonic
1074117135 10:110464713-110464735 GGCCTCAGGCTGGCACAGGCAGG - Intergenic
1074574522 10:114655901-114655923 GAGCTTTGGCTGGGACAGAGAGG - Intronic
1076387497 10:130067842-130067864 GGGCTATGACTGGTACAGAAGGG - Intergenic
1077439671 11:2562091-2562113 GGGCTGAGGGTGGCACAGTCGGG - Intronic
1078094869 11:8290553-8290575 GGGGTAAGGTAGGGACAGGCTGG + Intergenic
1078334422 11:10452085-10452107 GAGCTAAGGATGGGACTGAGAGG - Intronic
1083665406 11:64271538-64271560 GGGACAAGGCAGGGACAGACCGG + Intronic
1083796096 11:65017619-65017641 GGGCTAAGGCTGGGCCTCAGGGG + Intronic
1088078424 11:105879612-105879634 GGGCTAAGACAGGGACACACAGG - Intronic
1089177723 11:116560487-116560509 GGGCTGAGGCAGGGAGAGGCTGG + Intergenic
1089346811 11:117796379-117796401 GGGCTAAAGCCGGGGCAGAGGGG + Intronic
1089538198 11:119173543-119173565 GGGCAAAGGTTGGGCCAAACTGG - Exonic
1089574758 11:119433642-119433664 GGGCTAAGGCTGTGTCAGTGAGG - Intergenic
1091911252 12:4232357-4232379 GGGCCCAGGCTGGGAGAAACTGG + Intergenic
1094049062 12:26198931-26198953 GGGCTGAGGCTGAGTCACACTGG + Intronic
1097043080 12:56167844-56167866 GGGGAAAGCCTGAGACAGACAGG - Intronic
1098914455 12:76242817-76242839 GGCCTTAGGCTGGGAGAGAGGGG + Intergenic
1100945932 12:99784092-99784114 GGGCAAAGGATGGGACGGAGAGG - Intronic
1101988052 12:109462615-109462637 GGGCTGAGGCTGGGGCTGACAGG + Intronic
1102146794 12:110660390-110660412 GGGCTAAGGCCAGGACAGGCAGG + Intronic
1102349290 12:112180175-112180197 GGGCTGAGGGTGGGAGAGGCAGG + Intronic
1103951083 12:124551557-124551579 GGGCTAAGGCTCGGCCGGCCTGG + Intronic
1104820173 12:131672541-131672563 GGTCTAAGCCTGGGACACAGAGG + Intergenic
1104874751 12:132026224-132026246 GGGCCAAGGCAGGCACAGAGCGG - Intronic
1106668580 13:31880302-31880324 GGGCTAAGGCAGGAACTGGCTGG - Intergenic
1107020079 13:35742257-35742279 GGGTTAAGGCTGAGACCTACTGG - Intergenic
1110410568 13:75200075-75200097 GGGCTAAGGGAGGGAAAGCCAGG + Intergenic
1112184433 13:97114464-97114486 GGGTTAAGGCTGGCACAGCATGG + Intergenic
1114780772 14:25536140-25536162 GGGCCAAAGCTGGGAGAGAACGG - Intergenic
1114948311 14:27715174-27715196 AGGCAAAGGTTGGGACAGACTGG + Intergenic
1118327449 14:64791256-64791278 GGACTGTGGCTGAGACAGACAGG + Intronic
1118753618 14:68823130-68823152 GGGCTGACCCTGGGACAGGCAGG - Intergenic
1118905635 14:70021244-70021266 GGGGAAAGGCAGGGACAGGCAGG + Intronic
1119199940 14:72744744-72744766 GGACTCAGGCAGGGACAGAAAGG + Intronic
1122077255 14:99244115-99244137 GGGCTAAGGCTTGGACAGTGTGG - Intronic
1123421532 15:20140331-20140353 GGGCCCAGGCTGGGACATGCAGG + Intergenic
1123443523 15:20306184-20306206 GGGCCCAGGCTGGGACATGCAGG - Intergenic
1123530758 15:21146871-21146893 GGGCCCAGGCTGGGACATGCAGG + Intergenic
1124653137 15:31487388-31487410 GGGCTATGGCTGGGGCATCCTGG - Intronic
1125056622 15:35365977-35365999 GGGCAAAGGTGGGGAGAGACAGG + Intronic
1125426152 15:39551710-39551732 GGGGCAGGGCAGGGACAGACAGG - Intergenic
1126823862 15:52529786-52529808 GGAAGAAGGCTGGGACAGAAGGG - Intergenic
1128389609 15:67174196-67174218 GGAGGAAGGCTGGGTCAGACAGG - Intronic
1128450911 15:67805402-67805424 GCGCTGAGGTTGGGACAGCCAGG + Intronic
1129609119 15:77038870-77038892 GGGCGAGGGCTGGGAGAGGCGGG + Intergenic
1131062843 15:89414765-89414787 GAGATAAGGCTGGGGCAGAGAGG + Intergenic
1131160605 15:90102464-90102486 GGGCTAACGCTGGGCCTGGCGGG + Exonic
1131538110 15:93254171-93254193 TGGCTACAGCTGGAACAGACCGG + Intergenic
1134841538 16:17405667-17405689 AGGCTGAGGCTGGGGCAGGCAGG + Intronic
1135957856 16:26971268-26971290 TGGCCAAGGCTGGGACATCCAGG - Intergenic
1136172785 16:28498477-28498499 GGGCTTAGGCCGGCCCAGACGGG - Exonic
1136722691 16:32337702-32337724 GGGCCCAGGCTGGGACATGCAGG + Intergenic
1136841013 16:33543701-33543723 GGGCCCAGGCTGGGACATGCAGG + Intergenic
1138249041 16:55488523-55488545 GGGCTAAGGGTGGGGGAGAGAGG - Exonic
1141134742 16:81457953-81457975 GGGCGAAGGCAGGGACAGCGAGG - Intronic
1141606716 16:85158241-85158263 GGGGTATGCCTGGGACAGGCAGG + Intergenic
1203003740 16_KI270728v1_random:180062-180084 GGGCCCAGGCTGGGACATGCAGG - Intergenic
1203135348 16_KI270728v1_random:1716469-1716491 GGGCCCAGGCTGGGACATGCAGG - Intergenic
1203151178 16_KI270728v1_random:1843998-1844020 GGGCCCAGGCTGGGACATGCAGG + Intergenic
1143632967 17:8149302-8149324 GGCCTGAACCTGGGACAGACAGG + Exonic
1143941441 17:10546618-10546640 GTGTTAAGGCAGGGACAGAAAGG + Intronic
1144576904 17:16435247-16435269 GGGCAAAGGGTGTGACTGACTGG - Intronic
1144647528 17:16985574-16985596 GGGCAGAGGCTGGGACAGGATGG + Intergenic
1144677023 17:17168278-17168300 GGGCTGGGACTGGGCCAGACGGG - Intronic
1146132640 17:30291984-30292006 AGGCTGAGGCTGGGAGAAACGGG + Exonic
1146289398 17:31597026-31597048 TGGTCAAGGCTGGGACAGGCCGG + Intergenic
1146724551 17:35147050-35147072 GGGCAAGGGCTGGGTCAGACTGG - Intergenic
1146950187 17:36900210-36900232 GGGCCAGGGCTGGCACAGCCTGG + Intergenic
1148853761 17:50567456-50567478 GGGCTATGGCTGGGACCAGCTGG + Intronic
1149640370 17:58198947-58198969 GGGCTGGGGATGGGAGAGACGGG - Intronic
1150677545 17:67257920-67257942 GGGCCAAGGCTGAGCCACACAGG - Intergenic
1150985171 17:70188002-70188024 GGGCCAAGGGTGGGACTGATAGG - Intergenic
1151475951 17:74344446-74344468 CGGCTGAGGCTGGGACAGACAGG + Intronic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1151535706 17:74737684-74737706 GGGCTCAGGCTGGGAAGGGCTGG + Intronic
1151679297 17:75615199-75615221 GGGCCCAGGCAGGGACTGACAGG + Intergenic
1151748582 17:76024373-76024395 TGGCTAAGGCTGGGACACCGAGG - Intronic
1153321575 18:3778954-3778976 GAGCTCAGGTTGGGATAGACTGG - Intronic
1156113861 18:33762307-33762329 GGGATATGTGTGGGACAGACAGG + Intergenic
1160799509 19:961216-961238 GGGCGGAGGCTGGGACACAGCGG - Intronic
1160979451 19:1810233-1810255 GGGCTGAGGCTGAGACGGGCTGG - Intronic
1161163252 19:2772199-2772221 GGATTCAGGCTGGGTCAGACAGG + Intronic
1161312902 19:3604569-3604591 GGGCTCAGGCCGTGACAGGCAGG - Intronic
1161619051 19:5288915-5288937 GGGCTGAGTCAGGCACAGACAGG + Intronic
1161721289 19:5904058-5904080 GGGCTCAGACTGGGACGGGCGGG + Intergenic
1162028880 19:7909019-7909041 GGGCCAATGCTGGGCCAGGCGGG - Intronic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
1162931571 19:13960244-13960266 GGACAAACGCTGGGACAGCCGGG - Intronic
1163013718 19:14441059-14441081 GGGCAGAGGCTGGGCCAGGCTGG + Intronic
1163701125 19:18787159-18787181 GGGCTCAGGGTGGCACACACGGG - Intronic
1163776937 19:19224431-19224453 GGGGTAAGTCTGGGACTGGCAGG + Exonic
1164835968 19:31355235-31355257 GAGTTAAGGGTGGGCCAGACAGG - Intergenic
1165383593 19:35497447-35497469 GGGCCAGGGCTGGCACAGGCTGG + Exonic
1166117346 19:40663871-40663893 GGCCTAGGACTGGGACAGAGAGG - Intergenic
1166768180 19:45264920-45264942 GGGCTGAGGGTGGGGCTGACTGG + Intronic
1166909001 19:46137664-46137686 GGACCAAGGCTGGGCCACACTGG - Intergenic
1167087622 19:47320954-47320976 GGGACAAGTCTGGGAAAGACAGG - Exonic
1167408909 19:49333575-49333597 GGGCTATGTGGGGGACAGACTGG + Intergenic
1202691266 1_KI270712v1_random:96797-96819 GGGCCCAGGCTGGGACACGCAGG + Intergenic
924998141 2:382736-382758 GGGCTCAGGCTGGGTGAGATGGG - Intergenic
925330055 2:3051636-3051658 GTGCGAAGGCTGGGACAGAGGGG - Intergenic
925503360 2:4532062-4532084 GGGCTCAGGGTGTGTCAGACCGG - Intergenic
925926060 2:8671478-8671500 AGGCTCAGGGAGGGACAGACTGG + Intergenic
926952026 2:18253410-18253432 AGGCCAAGGTTGGAACAGACTGG + Intronic
927086730 2:19679601-19679623 AAGCTAAGACTGGGAGAGACTGG - Intergenic
927554339 2:24021850-24021872 GGCCTGAGGCTGGGGCAGAGGGG - Exonic
927863225 2:26573444-26573466 GGGCAGAGGCTGAGAGAGACAGG + Intronic
928168535 2:28988447-28988469 GGGCACAGGCTGGGCCAGATGGG - Intronic
931460676 2:62447866-62447888 GGGTGAAGGATGGAACAGACAGG - Intergenic
933955123 2:87357153-87357175 GGGCCCAGGCTGGGACACGCAGG - Intergenic
934239313 2:90253367-90253389 GGGCCCAGGCTGGGACATGCAGG - Intergenic
934273872 2:91563331-91563353 GGGCCCAGGCTGGGACACGCAGG + Intergenic
934323428 2:91985915-91985937 GGGCTCAGGCTGGGACATGAAGG - Intergenic
934588971 2:95529379-95529401 TGGGTAAGGCTGGAACACACTGG - Intergenic
934604250 2:95682297-95682319 GGGATAAGGATGGGGAAGACAGG + Intergenic
935697583 2:105783465-105783487 GAGCTAAGTCTGGCTCAGACAGG - Intronic
936045464 2:109184469-109184491 GACCCACGGCTGGGACAGACAGG - Intronic
936734855 2:115428238-115428260 GGGCTGAGGCTGGAACAGTGTGG - Intronic
937098968 2:119254135-119254157 GGGCTCAGGGTGAGACAGGCTGG + Intronic
938104674 2:128521696-128521718 GAGCTAAACCTGGGACAGGCGGG - Intergenic
940517153 2:154697475-154697497 GGGGGAAGGCAGGGACAGGCGGG + Intergenic
944337115 2:198548003-198548025 GGGCTAAGGCCAGGAAAGAGTGG + Intronic
946169107 2:217883853-217883875 GGGCTCAGGCGGAGAAAGACTGG - Intronic
947860203 2:233353214-233353236 GGCCTAAGGCAGGAACAGTCCGG - Intergenic
948462576 2:238137462-238137484 GGGCTATGGCTGGGCCAGGCTGG + Intergenic
948492157 2:238320601-238320623 GGGCTTAGGCTCGGCCAGGCCGG + Exonic
948658066 2:239489132-239489154 GGGCTGAGGCTGGGGCATTCCGG - Intergenic
1169346224 20:4829975-4829997 GGGCTTTGGCTGGGACAGCTGGG - Intergenic
1172206636 20:33167247-33167269 GGCCTCAGGCTGGGAAGGACTGG - Intronic
1172228563 20:33321807-33321829 GGAGTACGGCTGGAACAGACAGG + Intergenic
1173850705 20:46216165-46216187 GGCCTGAGCCTGGGACAGAGGGG + Intronic
1174297792 20:49561271-49561293 GGGCCAAGGCTGGGAAGGATGGG + Intronic
1175248872 20:57597142-57597164 GGGCCAAGGCTGTGAAAGGCCGG + Intergenic
1176251653 20:64124649-64124671 GACCTAAGGCTGTGCCAGACAGG - Intergenic
1176287780 21:5027845-5027867 GTGCCAAGGCTGGGTCAGAGGGG - Intronic
1176366767 21:6037922-6037944 GTGCTAAGGCTGGGAGGGCCTGG + Intergenic
1179756751 21:43500622-43500644 GTGCTAAGGCTGGGAGGGCCTGG - Intergenic
1179802515 21:43817531-43817553 GGGCTTGGGGTGGGACAGCCAGG + Intergenic
1179869401 21:44235630-44235652 GTGCCAAGGCTGGGTCAGAGGGG + Intronic
1180138748 21:45878110-45878132 GGGGTGAGGATGGGAGAGACTGG - Intronic
1180550183 22:16531786-16531808 GGGCCCAGGCTGGGACATGCAGG - Intergenic
1181354494 22:22290035-22290057 GGGCCCAGGCTGGGACACGCAGG + Intergenic
1181436048 22:22911548-22911570 GGGGTGAGGCTGGGGCACACGGG + Intergenic
1181440155 22:22931560-22931582 GGGTTAAGGCAGGCACAGCCAGG + Intergenic
1181466713 22:23114364-23114386 AGGCCCAGGGTGGGACAGACCGG + Intronic
1183079847 22:35449396-35449418 AGGCCATGGCTGGGACAGAGAGG - Intergenic
1183079883 22:35449575-35449597 GGGCCACGGCTGGGACAGAGAGG - Intergenic
1183444548 22:37844378-37844400 GGGCTCAGGCCGAGACAGAGCGG + Exonic
1183505426 22:38206004-38206026 GGGCTGAGGCTCGGACAGGAGGG + Intronic
1184226826 22:43133616-43133638 GGGATGGTGCTGGGACAGACAGG - Intronic
1184566273 22:45293970-45293992 GGGCTGTGGGTGGGAAAGACAGG + Intronic
1184806565 22:46798404-46798426 GGGGTGAGGCTGGGGCAGAGGGG + Intronic
1184848129 22:47101650-47101672 GTGCTAGGGCTGTAACAGACCGG + Intronic
950479686 3:13236713-13236735 GTGCTAGGGCTGGGACACAGAGG + Intergenic
952968491 3:38636275-38636297 GGTCCAAGGGTGGGGCAGACTGG - Intronic
954443194 3:50532960-50532982 GGAGTAAGGCTGAGACCGACTGG + Intergenic
954802618 3:53195953-53195975 GGGCCAAGACTGGGCCATACAGG - Intergenic
955612846 3:60775845-60775867 AGGGGAAGGCTGGGACAGCCAGG - Intronic
956744657 3:72301817-72301839 GGGGTAAGGCTAGGAAAGATGGG + Intergenic
960042136 3:113161613-113161635 GGGCTAAGGCTGGGGAAGAGAGG - Intergenic
967720536 3:192811372-192811394 GGTGTAAAGCAGGGACAGACAGG + Intronic
967821561 3:193843596-193843618 GGGCAGAGGCTGGGACAGCCTGG + Intergenic
968564118 4:1300701-1300723 TGGCTAAGGCTGGGCCTAACTGG + Intronic
968813645 4:2810991-2811013 GGACTGAGGCTGGCACAGGCTGG + Intronic
969272249 4:6110894-6110916 GGGCTGGGGCTGGGGCTGACTGG - Intronic
969417948 4:7073390-7073412 GGGCTGAGGCTGGGGCTTACAGG + Intergenic
969573711 4:8024592-8024614 GGTCCTAGGCTGGGACACACTGG + Intronic
969791931 4:9498561-9498583 GCCCAGAGGCTGGGACAGACGGG - Intergenic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
977693801 4:99946312-99946334 GGGCTGGGGCTGGCTCAGACAGG + Intronic
978608084 4:110504278-110504300 GGGTTGTGGCTGGGACAAACTGG + Intronic
981368495 4:143930569-143930591 GGGCAGAGGCTGGAACAGATTGG - Intergenic
987280854 5:16412237-16412259 GGGCTGAGGTAGGGACAGAATGG + Intergenic
989184504 5:38610170-38610192 GGGCAGAGGCTGGGACAGACAGG + Intergenic
994154655 5:96489640-96489662 GGGGTCATGCTGGGAAAGACAGG - Intergenic
995355733 5:111235969-111235991 GGGCTAAGACAGGAACAGGCAGG + Intronic
997476447 5:134145268-134145290 GGGCTCAGGATGGTACAGGCAGG - Intronic
998135398 5:139671657-139671679 GGGCTGCGGGTGGGCCAGACGGG - Intronic
998159201 5:139803650-139803672 GGCCTCAGACTGGGACAGTCCGG - Intronic
1002069724 5:176672115-176672137 GGGCCAAGGCTGTGGCAGAAAGG + Intergenic
1002660977 5:180791068-180791090 GGGCTAAGTGGGGGTCAGACAGG + Exonic
1002886414 6:1299288-1299310 GGGCTAAGGATGGGGCAGGGAGG + Intergenic
1002909665 6:1480167-1480189 GGGCTAGGGTTGGGATAGAATGG + Intergenic
1003634406 6:7819246-7819268 CTGCTAAAACTGGGACAGACTGG - Intronic
1004498679 6:16189334-16189356 GTGCTGAGGCTGAGACAGGCAGG - Intergenic
1005326245 6:24703448-24703470 GGCTTGAGGCTGGGACAGAAAGG + Exonic
1006431624 6:34000700-34000722 GGGCTGAGGGTGTGACAGTCAGG + Intergenic
1013794654 6:113873404-113873426 GGGCTCAGGCTGAAAGAGACTGG - Intergenic
1017070764 6:150573729-150573751 GGGGTAAGGCTGGGGAAGAAAGG - Intergenic
1018735349 6:166683800-166683822 TGGGTGAGGCTGGGACAGCCTGG + Intronic
1019603516 7:1897160-1897182 GGGCTAAGGCTGAATCAGACAGG + Intronic
1020278886 7:6640080-6640102 AGTCAAAGGCTGGGACACACAGG - Intronic
1023369617 7:39499978-39500000 GGGCAGAGGCAGGGACAGCCTGG - Intergenic
1023482271 7:40646622-40646644 GTGCAAAGACTGGGAAAGACTGG - Intronic
1023794484 7:43780495-43780517 AGGATAAGGAAGGGACAGACTGG - Intronic
1023889111 7:44380232-44380254 GGCCTAAGGAGGGGACAGCCAGG - Exonic
1024113907 7:46174057-46174079 GGGCTGAGGCTGATACCGACTGG - Intergenic
1025107243 7:56181857-56181879 GGGCTGAGGCTGGGATGGATGGG + Intergenic
1025946301 7:66107475-66107497 GGCTGAGGGCTGGGACAGACAGG + Intronic
1026023004 7:66725363-66725385 GGGCTGAGGGTGGGGCAGAATGG - Intronic
1026887748 7:73964235-73964257 GGGCTGAGGGTGGGGCAGAATGG - Intergenic
1027229492 7:76263960-76263982 GGCCTAGGGCTGGGCCAGTCTGG + Intronic
1028158931 7:87464145-87464167 GGGCTGAAGCTAGGTCAGACTGG + Intronic
1029560599 7:101300256-101300278 GGGCTCTGGCTGTGACAGACAGG - Intergenic
1029562010 7:101308952-101308974 GGGCTCTGGTTGTGACAGACAGG - Intergenic
1032081086 7:128858777-128858799 GGGCAGAGGCTGGGACACAAGGG + Exonic
1032117699 7:129130487-129130509 GTGCTAAAGCTGGGGCAGTCTGG - Intergenic
1032125114 7:129188323-129188345 TGGCTCAGGATGGGAAAGACAGG - Intergenic
1032542578 7:132715602-132715624 GGGCTTAGGCTGGGCCTGGCTGG + Intronic
1034396380 7:150828561-150828583 AGGGTGAGACTGGGACAGACTGG - Intronic
1035038400 7:155910197-155910219 GGACTCAGGCTGGGGCAGACGGG - Intergenic
1035093059 7:156330585-156330607 GGGCTTGGGCTGGGACAGGGAGG - Intergenic
1035658481 8:1329754-1329776 GGGCTCAGGCAGGTACAGCCGGG - Intergenic
1036618018 8:10403762-10403784 AGGCTCAGGCTGAGGCAGACGGG + Intronic
1037898138 8:22671938-22671960 TGGGAAAGGCTGGGAGAGACAGG - Intergenic
1042161712 8:65903784-65903806 GGGCAGAGGCTGGGACAGTTTGG + Intergenic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1046049726 8:109008794-109008816 GGGCTAGGGCTGTGGAAGACAGG + Intergenic
1046273222 8:111922737-111922759 GGGCTAATCTTGAGACAGACAGG - Intergenic
1046795898 8:118371428-118371450 GAGATAAGGCTGGGAAAGATGGG + Intronic
1047796552 8:128262484-128262506 GGGCTGAGGCTGAAACAGATTGG + Intergenic
1049060234 8:140270864-140270886 GGGCAGAGGCTGGGCCACACAGG + Intronic
1049227867 8:141466316-141466338 GGGCCATGGCGGGGGCAGACAGG + Intergenic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1053155495 9:35775457-35775479 TGGCCAAGGCTGGGAGAGAAGGG + Intergenic
1056695428 9:88846369-88846391 AGGCTGAAGCTGGGACAGCCAGG - Intergenic
1056896408 9:90554771-90554793 GGGCTCAGGCTGGAACAGGGTGG - Intergenic
1057125696 9:92614271-92614293 GGGCTGGGGCTGGGGCAGCCTGG - Exonic
1057255651 9:93545123-93545145 GGGCTGAGGCAGGGAGACACAGG - Intronic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1060550800 9:124484369-124484391 GGGCAAAGCCTGGGACTGAGCGG + Intronic
1060554206 9:124500024-124500046 GGGCTAAGGCTTGGGCAGCCGGG + Intronic
1061084459 9:128390972-128390994 GGACAAAGCCTTGGACAGACGGG - Exonic
1061489129 9:130935520-130935542 TGGATAGGGCTGGGACAGATGGG + Intronic
1062017438 9:134297841-134297863 AGGCTGAGGCTGGGAAGGACCGG + Intergenic
1062441298 9:136570929-136570951 GCCCCACGGCTGGGACAGACAGG + Intergenic
1185835065 X:3337918-3337940 CAGCAAAGGCTGGGAGAGACAGG + Intronic
1190625838 X:52337692-52337714 GGGCTGAGGCTGAGTCAGCCAGG - Intergenic
1190952913 X:55163252-55163274 GGGCTGAGGCTGAGTCAGCCAGG + Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1196740078 X:119017051-119017073 GGGCTAAGTCTTGGACAGTTAGG + Intronic
1196815915 X:119665525-119665547 GGGGAAAGGCTGTGGCAGACTGG + Intronic
1196987129 X:121286528-121286550 GGATTAAGGCAGGGATAGACAGG + Intergenic
1197446059 X:126552959-126552981 GGGTGAAGGCTGGGAGGGACAGG + Intergenic
1197719670 X:129736665-129736687 GGGCTAAGGCTGGGACCCAGAGG + Intergenic
1197806633 X:130404120-130404142 GGGCCTAGACTGGAACAGACTGG + Intronic