ID: 1059416697

View in Genome Browser
Species Human (GRCh38)
Location 9:114166957-114166979
Sequence ATCTGCTATCAGAAGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059416697_1059416708 16 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416708 9:114166996-114167018 GCTAGAGACACCTCGGGAGTGGG No data
1059416697_1059416705 10 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416705 9:114166990-114167012 TAGCCTGCTAGAGACACCTCGGG No data
1059416697_1059416704 9 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416704 9:114166989-114167011 GTAGCCTGCTAGAGACACCTCGG No data
1059416697_1059416707 15 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416707 9:114166995-114167017 TGCTAGAGACACCTCGGGAGTGG No data
1059416697_1059416714 28 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416714 9:114167008-114167030 TCGGGAGTGGGAAGGGGAATGGG No data
1059416697_1059416713 27 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416713 9:114167007-114167029 CTCGGGAGTGGGAAGGGGAATGG No data
1059416697_1059416709 20 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416709 9:114167000-114167022 GAGACACCTCGGGAGTGGGAAGG No data
1059416697_1059416711 22 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416711 9:114167002-114167024 GACACCTCGGGAGTGGGAAGGGG No data
1059416697_1059416710 21 Left 1059416697 9:114166957-114166979 CCATCACCCTTCTGATAGCAGAT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1059416710 9:114167001-114167023 AGACACCTCGGGAGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059416697 Original CRISPR ATCTGCTATCAGAAGGGTGA TGG (reversed) Intronic
902333818 1:15743621-15743643 ATCTGTTAGCTGAAGGGTGGTGG - Intronic
904391207 1:30187378-30187400 GTCTGTTAGCAGAATGGTGATGG + Intergenic
905863257 1:41363809-41363831 ACCTGCTACCAGCAGGGAGAGGG - Intronic
906156528 1:43617253-43617275 ATCACCTATCAGAAAAGTGATGG - Intronic
912506770 1:110161892-110161914 ATCTCCTGCCAGAGGGGTGAGGG - Intronic
913256973 1:116962665-116962687 TTCAGTTATCAGAAGGGAGACGG - Intronic
919123464 1:193369387-193369409 ATCTGATATCAGACAGGGGAAGG - Intergenic
920221931 1:204410684-204410706 GTCAGCTATCAGAACAGTGATGG - Exonic
921787510 1:219248444-219248466 ATATATTATCAGAAGGGTGAAGG + Intergenic
922565421 1:226598301-226598323 TTCTGCCCTCAGAAGGTTGAAGG + Intronic
922724755 1:227917658-227917680 ATGTGGGCTCAGAAGGGTGATGG + Intergenic
924173046 1:241360860-241360882 ATCTACTATATGAAGGGTGAAGG + Intergenic
924204409 1:241697114-241697136 CTCTGCTAACAGAAGGGTTGGGG - Intronic
1063796206 10:9516591-9516613 AGCTGTTATAAGAAGGGAGACGG + Intergenic
1064576931 10:16756148-16756170 ATCTTCAATTAGAATGGTGATGG + Intronic
1064832087 10:19480332-19480354 AACTGCTATCTGGAGGCTGATGG - Intronic
1065609217 10:27454671-27454693 ATTTTCTTTCAGAAGGGAGAAGG + Intergenic
1067013193 10:42733526-42733548 ATCTTCAATTAGAATGGTGATGG - Intergenic
1067310643 10:45110574-45110596 ATCTTCAATTAGAATGGTGATGG + Intergenic
1067732688 10:48823448-48823470 CTCTGCAGTCAGAAGGGTGCTGG - Intronic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068695113 10:59959216-59959238 GTCTGTTATCAGAAGTGTGGTGG + Exonic
1076186100 10:128450581-128450603 ATCCTCTATCAGATGAGTGAGGG + Intergenic
1076562503 10:131376405-131376427 ATCTGGTCTCAGGAGGCTGAAGG + Intergenic
1077176907 11:1195248-1195270 ATCAGCTGGCAGATGGGTGATGG - Intronic
1077267710 11:1660332-1660354 ACCAGCAATCAGAAGGGTAAAGG + Intergenic
1078891132 11:15560089-15560111 ACCTGCTGTCAGAAGCGGGAGGG + Intergenic
1079293158 11:19206974-19206996 CTGGGCTATCACAAGGGTGATGG - Intronic
1080555162 11:33409294-33409316 ATCAGATCTTAGAAGGGTGATGG + Intergenic
1082018016 11:47506752-47506774 AGTTGCTTTCAGAAAGGTGATGG - Intronic
1083560910 11:63672080-63672102 ATTAGCTATCAGAGCGGTGATGG - Intergenic
1084327626 11:68410969-68410991 ATCTGCTAAAAGAAGAGGGAAGG + Intronic
1085948585 11:81302233-81302255 TTCTGGAATCAGAAGGGTGAAGG + Intergenic
1088642749 11:111889216-111889238 GTCTGCCATCAGAAGACTGAAGG - Intergenic
1089339562 11:117748404-117748426 AAGTGCCATCAGAAGGGAGAGGG - Intronic
1091167591 11:133493188-133493210 ATCTTCTCTCAGAAGGGTACAGG - Intronic
1091261239 11:134236019-134236041 TTCTTCCATCAGAAGAGTGAAGG + Intronic
1092373524 12:7936452-7936474 AGCTGCTATTAGAAGAGGGAAGG - Intergenic
1093273178 12:17091433-17091455 ATCTGCAAGCTGAAGAGTGAGGG + Intergenic
1093416198 12:18923896-18923918 CTCTGGTGTCAGAAGGGTGCAGG - Intergenic
1093981143 12:25477074-25477096 ATCTGCTTTCAGGAGGTTAATGG - Intronic
1095341972 12:41100714-41100736 CTCTGCTATCTGCAGAGTGAAGG - Intergenic
1097158119 12:57027296-57027318 ATCTGTTTTCAGGCGGGTGAGGG - Intronic
1102876078 12:116449748-116449770 ATCTGCCATCAGCAAGCTGAAGG - Intergenic
1104565770 12:129880332-129880354 ATCTTATATCAGAAGTCTGATGG - Intronic
1106774983 13:33000070-33000092 ATCTGCTGTCCCAAGGGTGAGGG - Intergenic
1108116687 13:47136345-47136367 ATCTGCTAACAGCAGTGCGAAGG - Intergenic
1112110081 13:96286690-96286712 ATCTCCCATCAGGAGAGTGAAGG - Intronic
1113063874 13:106354830-106354852 ATTTGCTACCAGGAGGCTGAAGG - Intergenic
1113063967 13:106355715-106355737 ATTTGCTATCAGAAGGCTGAAGG + Intergenic
1116123308 14:40749201-40749223 ATCTGCTATTTGAGGGGTTATGG + Intergenic
1116897655 14:50332879-50332901 AGCTGATTTTAGAAGGGTGAAGG - Exonic
1117435212 14:55709174-55709196 GTCTATTTTCAGAAGGGTGAAGG - Intergenic
1118248659 14:64136884-64136906 CTCTGCAATCAGAGGGGTGGTGG + Intronic
1119091783 14:71789601-71789623 ATGTGCTATCCAAAGGCTGAGGG - Intergenic
1121744982 14:96281116-96281138 ATCTGCTATCAGAAGCATCAGGG + Intergenic
1125757177 15:42071767-42071789 ATCTGCTTTCTGGAAGGTGAGGG - Exonic
1127672154 15:61205626-61205648 ACCTGCAACCAGAAGAGTGAAGG + Intronic
1129704564 15:77786888-77786910 CTCTTCTATAAGAAGGGTGGTGG + Intronic
1130880605 15:88052518-88052540 ATCTGCTGTCAGAGGTGTCAGGG + Intronic
1137819198 16:51427413-51427435 CTCTTCTTCCAGAAGGGTGAGGG + Intergenic
1141160706 16:81627680-81627702 CTCTGCTATGAGATGGGGGAGGG - Intronic
1143999534 17:11040145-11040167 ATCTGGTGTCAGAAGTGTTATGG - Intergenic
1147033300 17:37659667-37659689 ATCTGCTATCAAAATGATGATGG - Intergenic
1147853615 17:43461305-43461327 ATCTTCTATCATAAGGGCCATGG - Intergenic
1147957773 17:44146580-44146602 ATCTGCTTTAGGAAGGGGGAAGG - Intronic
1154040269 18:10847867-10847889 ATCTTCTAACAAAAAGGTGAAGG + Intronic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156309828 18:35911683-35911705 TTCTGCTCTCAGAAGAGTGTGGG - Intergenic
1156957599 18:42987375-42987397 TTCTGAAATCAGCAGGGTGAGGG - Intronic
1162039468 19:7961331-7961353 ACCTTCCATCAGAAGGGTGTTGG + Exonic
1162039475 19:7961359-7961381 ACCTTCCATCAGAAGGGTGTTGG + Exonic
1162039482 19:7961387-7961409 ACCTTCCATCAGAAGGGTGTTGG + Exonic
1162039489 19:7961415-7961437 ACCTTCCATCAGAAGGGTGTTGG + Exonic
1165889430 19:39101531-39101553 ATCTGCTGTGAGCAGGGGGAAGG + Exonic
925619252 2:5774730-5774752 GGCTGCTAGCAGGAGGGTGAGGG - Intergenic
927241415 2:20922882-20922904 ATCTGCAGTCAGGAGGGAGAGGG - Intergenic
930357022 2:50333943-50333965 ATCTGCAAAGAGAATGGTGAAGG - Intronic
930707698 2:54520853-54520875 CTCTGCTATTAGAGGGATGAGGG + Intronic
932021889 2:68095842-68095864 ATCTGCCATAGGAAGGGTGGAGG + Intronic
932072246 2:68632842-68632864 ATCTGATTTCAGAGTGGTGAAGG - Intergenic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
935221861 2:101022092-101022114 ATCTACTTTCTGAAGGGGGATGG - Intronic
936051633 2:109228425-109228447 ATCTGGTATCAGAAGTGTTCTGG - Intronic
936515183 2:113176862-113176884 GTCTGATCTCAGAAGGGTGGAGG - Intronic
936928008 2:117757818-117757840 GTCTGCAATGAGAAGGTTGAAGG + Intergenic
939024636 2:136997600-136997622 TTCTGCTATCAGAAGCCTAAGGG - Intronic
940655999 2:156488788-156488810 GTTTGCTATCAGAATGCTGAAGG + Intronic
941020607 2:160404848-160404870 TTCTGAGATTAGAAGGGTGATGG + Intronic
941294636 2:163721132-163721154 TTCTTCTACCAGAAGGGTAAAGG + Intronic
941628874 2:167862217-167862239 ATCTGCTCTCTGCAGGCTGAAGG + Intergenic
943115701 2:183667340-183667362 ATACTCTACCAGAAGGGTGATGG + Intergenic
944319683 2:198324526-198324548 ATCTGGGATCAGAAATGTGAGGG + Intronic
946110782 2:217413673-217413695 ATCTATGACCAGAAGGGTGAAGG - Intronic
947033327 2:225822999-225823021 TTCTGATATGAGAAGGGTGGGGG + Intergenic
948890894 2:240906612-240906634 ACCTGCTCTCAGGAGGGTGCAGG - Intergenic
1170605845 20:17874530-17874552 CTCTGGTATCAGAAGGGTCTGGG + Intergenic
1172831083 20:37835248-37835270 ATCTGTTATCTGCAGGTTGAAGG - Intronic
1173233645 20:41223365-41223387 ATCTACTATCAGCATGGTAATGG + Intronic
1176345600 21:5742956-5742978 TTTTGATATCAGAAGGGTGCTGG + Intergenic
1176352414 21:5863540-5863562 TTTTGATATCAGAAGGGTGCTGG + Intergenic
1176499227 21:7581499-7581521 TTTTGATATCAGAAGGGTGCTGG - Intergenic
1176539921 21:8141026-8141048 TTTTGATATCAGAAGGGTGCTGG + Intergenic
1176558872 21:8324071-8324093 TTTTGATATCAGAAGGGTGCTGG + Intergenic
1177566762 21:22832941-22832963 ATCTGATATAAGAATAGTGACGG - Intergenic
1178806819 21:35846252-35846274 CTATGCTATCTGGAGGGTGAAGG + Intronic
1180581579 22:16844289-16844311 ATCTGTCCTCAGAAGAGTGAGGG - Intergenic
1203244872 22_KI270733v1_random:57381-57403 TTTTGATATCAGAAGGGTGCTGG + Intergenic
953577759 3:44126978-44127000 ACCTGCCATCAGAAGGTGGATGG + Intergenic
955776437 3:62438597-62438619 ATATATTATCAGACGGGTGATGG + Intronic
957832673 3:85543731-85543753 CTCTGCTATCACATGGCTGAAGG + Intronic
963061135 3:141227911-141227933 AGCTGCTCTCAGGAGGGGGAAGG + Intergenic
968887470 4:3342044-3342066 ATCTGCTTCCAGAAAGGTGCAGG + Intronic
970160162 4:13180194-13180216 ACCTGCTTTCAGAACTGTGAGGG - Intergenic
971906963 4:32738652-32738674 ATCATCTTTCAGAAGGATGAAGG - Intergenic
973717174 4:53688465-53688487 ATCTACAAACAGAGGGGTGATGG - Intronic
975387538 4:73774564-73774586 ATGTGCAATGAGAAGGGTGTGGG - Intergenic
975409408 4:74031984-74032006 TTCTGTTATCAGAAGGTAGAAGG - Intergenic
978425338 4:108576484-108576506 ATCAGATATCAGATGAGTGAGGG + Intergenic
979557761 4:122069508-122069530 ATGTGATATCAGAAGAGAGAGGG - Intergenic
980899458 4:138890679-138890701 CTCTGCTACCAGATGGATGATGG + Intergenic
984672077 4:182502086-182502108 ATTTGCTCTCAGAATTGTGAAGG + Intronic
988024299 5:25665467-25665489 AGCTGCTACCTCAAGGGTGAGGG + Intergenic
988231815 5:28489111-28489133 ATCTGGTATCAGAAGCAGGAAGG + Intergenic
990436842 5:55801263-55801285 ATCAGCTATCAGTAGTGTTACGG + Intronic
994977790 5:106832143-106832165 ATCTGCTATCAGTGGCTTGAAGG + Intergenic
995384211 5:111570660-111570682 ATATGCTATGATAAGGGTTAAGG - Intergenic
996252990 5:121360617-121360639 ATCTGCTATCAGGAAGGCCATGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999037043 5:148363359-148363381 ATCTGCTAGCTGAATGGTGCAGG + Intergenic
1000739541 5:164950684-164950706 ATCTGCTATCAAAGGAGAGAAGG - Intergenic
1007507283 6:42345804-42345826 ATATGCTGTCAGAATGGAGAAGG - Intronic
1013302513 6:108817890-108817912 GTCAGCTATCAGAAGACTGAAGG + Intergenic
1014504881 6:122242837-122242859 ATCTGCTATGAGATGGGGGCTGG - Intergenic
1018385896 6:163303040-163303062 ATCTGAGATGAGCAGGGTGAGGG + Intronic
1023875355 7:44283628-44283650 CTCTGCTGTCAGAAGGCAGATGG + Intronic
1025794776 7:64729409-64729431 ATCTGCTCTCAGAAGGATTATGG + Intergenic
1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG + Intergenic
1029417258 7:100450854-100450876 GTCTGCTGTCAGAAGGGGGCGGG - Intergenic
1029907264 7:104104364-104104386 AACTCCTGGCAGAAGGGTGAAGG - Intergenic
1030846321 7:114417185-114417207 ATCTGCTTTCAGAATGGAGTTGG - Intronic
1031747131 7:125513916-125513938 TACTGCTATCTGGAGGGTGAAGG + Intergenic
1031953065 7:127911905-127911927 GTCTTCCATCATAAGGGTGAGGG - Intronic
1032015011 7:128373863-128373885 ATCTGCTGTCTGTAGGCTGAAGG + Intergenic
1034908346 7:154971155-154971177 ATCTGATCTCAGAGGGCTGAGGG + Intronic
1035854523 8:2959951-2959973 ATTTGTTATAAGGAGGGTGAAGG + Intronic
1043212708 8:77544600-77544622 ATCTGCTATGATAAGTGTGTTGG + Intergenic
1043231125 8:77802801-77802823 ACCTGCTATCAAAAAGGTCAGGG - Intergenic
1044158795 8:88886420-88886442 ATCTGCTGTCAGATGAGTGATGG + Intergenic
1045392498 8:101729521-101729543 ATCTCCTATGTGAAGGGTCATGG + Intronic
1045556314 8:103218072-103218094 AACTGCTTTCCAAAGGGTGATGG + Intronic
1052127589 9:24796922-24796944 GTCTCCACTCAGAAGGGTGAAGG + Intergenic
1053613376 9:39738578-39738600 ATCTGCTACCAGTTGGGAGATGG - Intergenic
1053871418 9:42496535-42496557 ATCTGCTACCAGTTGGGAGATGG - Intergenic
1054240139 9:62603823-62603845 ATCTGCTACCAGTTGGGAGATGG + Intergenic
1054554272 9:66638348-66638370 ATCTGCTACCAGTTGGGAGATGG + Intergenic
1055662340 9:78517672-78517694 AGGTGCCATCAGAAGGGAGATGG + Intergenic
1057750824 9:97791524-97791546 ATCTGCTATCTGCAAGCTGAAGG + Intergenic
1058061471 9:100501298-100501320 ATCCACTATCAAAAGGTTGAGGG - Intronic
1058704829 9:107629553-107629575 ATCTGATATCTGAAGGGTGAGGG - Intergenic
1058845764 9:108957592-108957614 TTCTGATTTCAGAATGGTGAGGG + Intronic
1059416697 9:114166957-114166979 ATCTGCTATCAGAAGGGTGATGG - Intronic
1059802313 9:117762923-117762945 ATATTCTAAAAGAAGGGTGATGG + Intergenic
1060503809 9:124182796-124182818 ATCTGCTATCAGAACCCAGAAGG + Intergenic
1203461203 Un_GL000220v1:40464-40486 TTTTGATATCAGAAGGGTGCTGG + Intergenic
1186103455 X:6181098-6181120 AGCTGCTATCAGAAATATGAGGG + Intronic
1187154417 X:16710453-16710475 AGCTGATATCATAAGGGTCACGG - Intronic
1189293819 X:39904748-39904770 TTCTGCTTTCAGGAGGGTGAAGG + Intergenic
1191858313 X:65645230-65645252 ATCAGCTATCAGAAGCGAGGAGG - Intronic
1192212773 X:69138073-69138095 ATTTGCGATCAGAGAGGTGAAGG - Intergenic
1193168184 X:78305414-78305436 AACTTTGATCAGAAGGGTGAGGG - Intronic
1197679640 X:129368623-129368645 GTTTGCTATCAGGAAGGTGAGGG - Intergenic
1199708385 X:150450721-150450743 TTTTGCCATCAGAAGAGTGATGG + Intronic
1199744978 X:150766816-150766838 TTCTGCAAACAGAAGGCTGAGGG + Exonic
1199772025 X:150981196-150981218 ATGAACTATCTGAAGGGTGAGGG + Intronic
1199773137 X:150987345-150987367 TTCTGCTATCAGTAGGTTGCAGG + Intronic
1201721555 Y:17103914-17103936 ATCTGTTCTTAAAAGGGTGATGG + Intergenic
1202061736 Y:20896281-20896303 TTCTTCTATGAGAGGGGTGAAGG - Intergenic