ID: 1059417028

View in Genome Browser
Species Human (GRCh38)
Location 9:114168603-114168625
Sequence TGTGATGGTTGAGCGGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059417028_1059417036 27 Left 1059417028 9:114168603-114168625 CCTGCGGCCGCTCAACCATCACA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1059417036 9:114168653-114168675 AAGCCTCCCTACCAAGCCTTCGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059417028 Original CRISPR TGTGATGGTTGAGCGGCCGC AGG (reversed) Exonic
902079434 1:13811271-13811293 TGTGAAGGTTAAGGGGCCTCTGG + Intronic
905948008 1:41919983-41920005 TGTGATGCTGGAGCGGCTGTAGG - Intronic
923205894 1:231758523-231758545 GGTGCTGGTTGAGCAGCCCCAGG + Intronic
924291473 1:242541107-242541129 GGTGATGGTTTAGAGGCCACAGG + Intergenic
1072434140 10:95400286-95400308 TGAGCTGGTTGTGTGGCCGCAGG - Intronic
1075799082 10:125141538-125141560 TGGGGTGGTTGAGCGCCCTCAGG - Intronic
1077888380 11:6402421-6402443 TGGGATGGATGAGCGACCCCAGG - Intronic
1083811350 11:65108518-65108540 TGCGCTGGTGGAGCGGCGGCTGG + Exonic
1088788493 11:113203587-113203609 TGTGGTGGCTGAGCTGCCCCCGG - Intronic
1089136424 11:116252901-116252923 TGTGGTGGTAGAGTGGCTGCAGG + Intergenic
1100878574 12:98991041-98991063 TGTGATGGATGAGGGACCTCAGG + Intronic
1105725551 13:23159747-23159769 TCTGAGGGTGGAGAGGCCGCCGG + Intergenic
1113877923 13:113606191-113606213 TGCGGTGGTTGAGTGTCCGCAGG + Intronic
1130046615 15:80450740-80450762 GATGATGGCAGAGCGGCCGCAGG + Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134529865 16:14975018-14975040 CCTGATGGTTGAGAGGCGGCGGG - Intronic
1139834933 16:69830622-69830644 TGTGAGTGTTGGGGGGCCGCGGG + Intronic
1139866481 16:70065936-70065958 CCTGATGGTTGAGGGGCGGCGGG + Intergenic
1139908325 16:70381395-70381417 AGTGGGGATTGAGCGGCCGCTGG + Exonic
1142425842 16:90001860-90001882 TGTCCTGGGTGAGCGGCCGGAGG + Intergenic
1153820208 18:8825778-8825800 TGTGGTGGTGGAGCGGGCCCAGG - Exonic
1163014029 19:14442870-14442892 TGTGATGCTTGAGGGGACCCTGG - Intronic
1166433175 19:42743220-42743242 TGTGCTGGTTGAGCCCCTGCTGG + Intronic
1166436273 19:42768447-42768469 TGTGCTGGTTGAGCCCCTGCTGG + Intronic
1166453531 19:42920625-42920647 TGTGCTGGTTGAGCTTCTGCTGG + Intronic
1166456022 19:42939936-42939958 TGTGCTGGTTGAGCCCCTGCTGG + Intronic
1166465809 19:43029205-43029227 TGTGCTGGTTGAGCCTCTGCTGG + Intronic
1166471950 19:43085405-43085427 TGTGCTGGTTGAGCCCCTGCTGG + Intronic
1166485557 19:43208328-43208350 TGTGCTGGTTGAGCCCCTGCTGG + Intergenic
930259245 2:49125983-49126005 TGTTATGATTAAGCGGCAGCAGG - Intronic
939003548 2:136761868-136761890 TGTGAGTGTTGAGCGTCTGCTGG + Intergenic
943730032 2:191292734-191292756 TCTGATGGTTGAGGGGCCTTAGG + Intronic
1168919369 20:1518319-1518341 TATGATGGTTGAGCCTCAGCTGG - Intergenic
1169996366 20:11561723-11561745 TGTGATGGTTGAGATGCCTATGG + Intergenic
1171358106 20:24566173-24566195 TGTGATGGTTGAAGGCCTGCTGG + Intronic
1173227018 20:41168073-41168095 TGTGGTTGGTGAGCGACCGCAGG + Intronic
1176195385 20:63834504-63834526 TATGAGGGATGAGCGGCAGCAGG + Intergenic
1179981809 21:44899834-44899856 TGAGCTGGGTGAGCGGCTGCGGG - Intronic
1180866974 22:19125346-19125368 TGTCATGGATGTGCAGCCGCTGG - Intergenic
957410916 3:79838535-79838557 TGTGATGCTTGTGCTGCCGCAGG + Intergenic
964035561 3:152192369-152192391 TGTGATGGTGGAGAGACTGCTGG - Intergenic
968022072 3:195401213-195401235 TGTGATTGTTGAGCAGCCTGTGG - Intronic
973604283 4:52571178-52571200 TGTGATGCTTGAGAGGCTGCAGG - Intergenic
984844613 4:184099012-184099034 TGTGATGGTTCAGTGGACGTTGG - Intronic
994149431 5:96431779-96431801 GGTGGTGGTTGAGACGCCGCTGG - Intronic
1011167944 6:84471372-84471394 TGTTATGGTTGAGAGACTGCTGG - Intergenic
1019664584 7:2245253-2245275 TGTGAGGGTTGAGGGGCGTCTGG - Intronic
1028796283 7:94907735-94907757 TGTAATGGAGGAGAGGCCGCGGG - Intronic
1034255162 7:149720780-149720802 TGTGAGTGCTGAGCAGCCGCAGG + Intronic
1034985428 7:155510177-155510199 TGTGAATGTAGCGCGGCCGCTGG - Intronic
1038789672 8:30657652-30657674 TGTGGAGTTTGAGCAGCCGCGGG - Intronic
1059417028 9:114168603-114168625 TGTGATGGTTGAGCGGCCGCAGG - Exonic
1195711362 X:107775904-107775926 TGTGACGGCTGAGCGGTGGCAGG + Intronic