ID: 1059420835

View in Genome Browser
Species Human (GRCh38)
Location 9:114191060-114191082
Sequence GTTGAGGCTGGAAAAAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059420835_1059420838 -1 Left 1059420835 9:114191060-114191082 CCTTGTCTTTTTCCAGCCTCAAC No data
Right 1059420838 9:114191082-114191104 CTTAGCTGTAACTCCCTTCAAGG No data
1059420835_1059420841 16 Left 1059420835 9:114191060-114191082 CCTTGTCTTTTTCCAGCCTCAAC No data
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059420835 Original CRISPR GTTGAGGCTGGAAAAAGACA AGG (reversed) Intronic