ID: 1059420836

View in Genome Browser
Species Human (GRCh38)
Location 9:114191072-114191094
Sequence AGTTACAGCTAAGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059420836_1059420841 4 Left 1059420836 9:114191072-114191094 CCAGCCTCAACTTAGCTGTAACT No data
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059420836 Original CRISPR AGTTACAGCTAAGTTGAGGC TGG (reversed) Intronic