ID: 1059420841

View in Genome Browser
Species Human (GRCh38)
Location 9:114191099-114191121
Sequence TCAAGGATTTACCTCCGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059420836_1059420841 4 Left 1059420836 9:114191072-114191094 CCAGCCTCAACTTAGCTGTAACT 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data
1059420837_1059420841 0 Left 1059420837 9:114191076-114191098 CCTCAACTTAGCTGTAACTCCCT 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data
1059420835_1059420841 16 Left 1059420835 9:114191060-114191082 CCTTGTCTTTTTCCAGCCTCAAC 0: 1
1: 0
2: 3
3: 26
4: 418
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data
1059420834_1059420841 19 Left 1059420834 9:114191057-114191079 CCTCCTTGTCTTTTTCCAGCCTC 0: 1
1: 0
2: 5
3: 82
4: 1199
Right 1059420841 9:114191099-114191121 TCAAGGATTTACCTCCGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059420841 Original CRISPR TCAAGGATTTACCTCCGTCT AGG Intronic
No off target data available for this crispr