ID: 1059421346

View in Genome Browser
Species Human (GRCh38)
Location 9:114194429-114194451
Sequence CACCAGGAAAGGCCCACGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059421333_1059421346 28 Left 1059421333 9:114194378-114194400 CCAAAGTGGAATTGTTTTTGTTT 0: 1
1: 0
2: 6
3: 89
4: 820
Right 1059421346 9:114194429-114194451 CACCAGGAAAGGCCCACGATGGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059421346 Original CRISPR CACCAGGAAAGGCCCACGAT GGG Exonic
900571856 1:3362530-3362552 CACCAGGCCAGGCTCACGGTGGG + Intronic
900981814 1:6050045-6050067 CCCCAGGAAAGGCCCAGCCTGGG + Intronic
903068963 1:20717368-20717390 CAGGAGGAAAGGCCCTCGAGGGG - Intronic
903124424 1:21238032-21238054 GAGCAGGAAAGGCCCAGGGTGGG + Intronic
911233037 1:95380637-95380659 CACTAGGTAAGTCCCATGATAGG + Intergenic
922734178 1:227970730-227970752 CACCCGGAAAGGCCGCCGAGAGG - Intergenic
923317860 1:232798924-232798946 CACCAGGAAAGACTGACTATGGG - Intergenic
1067759647 10:49035119-49035141 AACCAGGAAAGGCCACCCATGGG + Intronic
1078463585 11:11533743-11533765 CACCAGGGCAGGCCAATGATTGG - Intronic
1078962859 11:16299786-16299808 CACCAGGAAAGGCCAAAGAAAGG + Intronic
1079560183 11:21811783-21811805 TTCCAGTAAATGCCCACGATGGG + Intergenic
1083811157 11:65107748-65107770 CCCCAGGAAAGGCCCACTGCAGG - Intronic
1088819770 11:113447308-113447330 CCCCAGGAAAGGCACAGGAGCGG - Intronic
1091305060 11:134531455-134531477 CAGCAGGAGAGGCCCAGGAAAGG - Intergenic
1102116072 12:110403809-110403831 CACCTGAAAAGGACCACGACAGG - Intergenic
1102718530 12:114996066-114996088 CATGTGGAAAGGCCCACGCTGGG + Intergenic
1102796722 12:115695323-115695345 CCCCAAGAAAGACCCAAGATAGG - Intergenic
1103833347 12:123798459-123798481 CACCAGGACAGTCCCAAGAGAGG + Intronic
1106336658 13:28789429-28789451 CACCCGGAAAGGGCAAGGATGGG - Intergenic
1112151593 13:96770769-96770791 CAGCAGAAAAGGCCCACAAAGGG - Intronic
1113450397 13:110405390-110405412 TCCCAGGAAAGGCCCACTAGTGG + Intronic
1116614220 14:47113327-47113349 CAACAAAAAAGGCCCACGACCGG + Intronic
1121467847 14:94127575-94127597 GCCCAGAAAAGGCCCACGAATGG + Intergenic
1123137086 14:106038056-106038078 CCCCAGGAAAGGCCCTGGAGTGG - Intergenic
1130887662 15:88107619-88107641 GACCAGGAATGGGCCACAATTGG - Intronic
1131962649 15:97805822-97805844 CCCCAAGAAAGGCCAAGGATAGG + Intergenic
1136087973 16:27899098-27899120 GGCCAGGAAAGGCCCTCCATGGG + Intronic
1139551363 16:67674864-67674886 GACCAGGAAAGGCTCACCCTGGG - Exonic
1140710277 16:77671096-77671118 CACTAGGAAATGCCCAATATGGG + Intergenic
1141844151 16:86595692-86595714 CACCAGAACAGGTCCAGGATTGG - Intergenic
1142419841 16:89963454-89963476 CAGCAGGACTGGCCCCCGATGGG + Intronic
1142854840 17:2723909-2723931 CCCCAGGAGAGGCCCAGGCTAGG - Intergenic
1143053719 17:4146851-4146873 CTCCATGAAATGCCCACAATAGG - Intronic
1143454916 17:7060840-7060862 CACAAGGAAACACCCACGACAGG + Intergenic
1147849978 17:43434871-43434893 CACCAGGAATGACTCAAGATCGG - Intergenic
1148235736 17:45967849-45967871 AACCAGGAATGGCCCAGGATGGG - Intronic
1148904917 17:50905764-50905786 CACCAGGGAGGGCCCAGGTTTGG + Intergenic
1149638578 17:58189282-58189304 CACGATGAAAAGCCCACGAGGGG + Intergenic
1151271811 17:73002621-73002643 CAAGAGGAAAGGCACACTATGGG + Intronic
1151538057 17:74749627-74749649 CACCAGGGAAGGAGCAGGATTGG - Intronic
1152603041 17:81274721-81274743 AACCAGGACAGCCCCACGCTCGG + Intronic
1153215501 18:2816709-2816731 CACCTGGAAAGCCTCAGGATGGG + Intergenic
1156466115 18:37348707-37348729 GACCAGGAATGACCCCCGATGGG - Intronic
1160147254 18:76375625-76375647 GACCTGGGAAGGCCCAAGATGGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162501438 19:11056343-11056365 CTCCAGGGAGGGCCCACGATGGG + Intronic
1165149037 19:33750327-33750349 CACCAGCATAGGCACACGCTGGG + Intronic
1165227770 19:34366359-34366381 CACCAGGATATGCCCATGGTTGG - Exonic
1165756911 19:38298873-38298895 CAGCTGGAAAGGCCCAGGCTTGG - Intronic
1166265922 19:41684347-41684369 CATCAGGAAAGGACCAGGAGAGG - Intronic
1166345559 19:42163190-42163212 AACCAGGAATGGCCCACAAAGGG + Intronic
925047051 2:780446-780468 CACCAGGGAAGGCCAAGGATGGG - Intergenic
925386884 2:3468154-3468176 CAGCAGGAACAGCCCACGAGAGG - Intronic
928589845 2:32803051-32803073 CACCAGGAAGGTCACACGTTAGG - Intronic
933929437 2:87133901-87133923 CACCTGAAAAGGCCCACAAGGGG - Intergenic
934000767 2:87709693-87709715 CACCTGAAAAGGCCCACAAGGGG - Intergenic
935341913 2:102066076-102066098 CTCCAGGAAAGGCACAAGGTTGG - Intronic
936363502 2:111829484-111829506 CACCTGGAAAGGCCCACAAGGGG + Intronic
937801000 2:126080100-126080122 CACAAGTAAAGTCCCACAATAGG - Intergenic
1172162161 20:32876172-32876194 CACCAGGCAAGTCCCCCGACTGG - Intronic
1172670317 20:36630503-36630525 CCCCAAGAAAGGCCCACGTGGGG - Intronic
1173670325 20:44794327-44794349 CCCCAGAAAAGGCCCAGGCTGGG - Intronic
1180123278 21:45768216-45768238 CATCAGCAAAGGCCCACGCAGGG - Intronic
1181832080 22:25568223-25568245 CACAAGCAAAGGCCCACAAAGGG + Intronic
1184040478 22:41940147-41940169 CACCAGGCAAGTCCCACACTCGG + Intronic
949962016 3:9320102-9320124 CTCCAGGAAAGCACCAAGATTGG - Intronic
950110068 3:10413127-10413149 CACCAGGCTAGGCCCACAGTGGG - Intronic
959462997 3:106650282-106650304 CACAAGGTAAATCCCACGATAGG + Intergenic
961604812 3:128085749-128085771 TGCCAGGAAAGGCCCAGGAGAGG + Intronic
963121137 3:141778077-141778099 CGCCAGGAACTGCACACGATAGG - Intergenic
966975635 3:185080813-185080835 CTCTAGGAAAGGCCCAGGAGAGG - Exonic
968578526 4:1379023-1379045 CCCCAGGCACGGCCCACGCTAGG - Intronic
976089091 4:81436640-81436662 AAACAAGATAGGCCCACGATCGG - Intronic
985146915 4:186903119-186903141 CAGCAGGTAAGGCCCACCAACGG - Intergenic
986241345 5:5962270-5962292 CACCAGCACAGGCCCCCGAACGG + Intergenic
986578376 5:9236234-9236256 CCCCAGGCAAGGCCCACGGCAGG + Intronic
992237813 5:74730300-74730322 CACCTGGAGAGGCCCGAGATAGG + Exonic
998531803 5:142892022-142892044 GTCCAGGACAGGCCCACGAGCGG - Intronic
1000223142 5:159233569-159233591 CACAGGTAAAGTCCCACGATAGG + Intergenic
1001313917 5:170629599-170629621 GACCAGCAAAGGCCCAAGATGGG - Intronic
1002404509 5:179019351-179019373 AAGCAGGGAAGGCCCAAGATAGG - Intergenic
1002484508 5:179524901-179524923 CTCCAGGAGAGGCCCAGGTTGGG - Intergenic
1002500071 5:179642587-179642609 CTCCAGGAGAGGCCCAGGTTGGG + Intronic
1002501900 5:179652174-179652196 CTCCAGGAGAGGCCCAGGTTGGG - Intergenic
1003678240 6:8226910-8226932 CACCAGGTCAGGCCCAGGTTAGG + Intergenic
1008379358 6:50824250-50824272 CAGCAGGACAGCCCCACTATGGG - Intronic
1014651051 6:124037920-124037942 CTGAAGGAAAGGCCCATGATTGG + Intronic
1018847679 6:167566765-167566787 CACCAGGGAAGGGCCAGGAAGGG - Intergenic
1018861027 6:167710685-167710707 CACCAGGAAAGACCCAGCAAGGG - Intergenic
1029244108 7:99186229-99186251 CCCCAGGACAGGTCTACGATTGG + Intronic
1033032522 7:137841213-137841235 CACCAGGAAAACTCCTCGATTGG - Intronic
1034296023 7:149973068-149973090 CCCCAGGTAAGCCCCACGAGCGG + Intergenic
1034810007 7:154123741-154123763 CCCCAGGTAAGCCCCACGAGCGG - Intronic
1034810027 7:154123835-154123857 CCCCAGGTAAGCCCCACGAGCGG - Intronic
1035475002 7:159137006-159137028 CACCAGGAGAGGCCATCGACTGG + Intronic
1037705674 8:21313682-21313704 CAGTAGGAAAGGACCACGCTGGG + Intergenic
1037779826 8:21860220-21860242 CCCAAGGAAAGGCCCACTATGGG + Intergenic
1038536015 8:28353200-28353222 CAGCAGGAAAGGGTCAGGATCGG + Exonic
1048304969 8:133277914-133277936 CACCAGGAAAGGGCACCCATGGG + Intronic
1048829828 8:138465255-138465277 TACTAGGAAAGGACCATGATGGG - Intronic
1049409827 8:142467631-142467653 CACCAGGACAGGGCCAGGGTGGG + Intronic
1051247122 9:15123300-15123322 CACCAGGAAAGGCTCAGGAATGG + Intergenic
1052789402 9:32860656-32860678 CACCAGTGAAGTCCCACAATAGG + Intergenic
1057520529 9:95756123-95756145 CAACAGGAATGTCCCAGGATGGG + Intergenic
1058771860 9:108241815-108241837 CAACAAGAAAGGCCCAAGGTAGG + Intergenic
1059389665 9:113991024-113991046 CACCAGGAGATGCCCAGGAAAGG + Intronic
1059421346 9:114194429-114194451 CACCAGGAAAGGCCCACGATGGG + Exonic
1061607479 9:131722188-131722210 CACCTGGAGATGGCCACGATAGG - Intronic
1186435739 X:9541792-9541814 CACCAGGAATGACCCTCGCTAGG + Intronic
1192537086 X:71937352-71937374 CACCAGGAAGGGCCTAGGTTTGG + Intergenic
1201931522 Y:19354686-19354708 CACCAGGAAAGGCCCCAGTAAGG + Intergenic