ID: 1059421807

View in Genome Browser
Species Human (GRCh38)
Location 9:114196882-114196904
Sequence GGTGCTCCAGGAGGACTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059421807_1059421811 -5 Left 1059421807 9:114196882-114196904 CCAGGAAGTCCTCCTGGAGCACC No data
Right 1059421811 9:114196900-114196922 GCACCCAGCTTCAGGCCATGAGG No data
1059421807_1059421816 30 Left 1059421807 9:114196882-114196904 CCAGGAAGTCCTCCTGGAGCACC No data
Right 1059421816 9:114196935-114196957 CAAGAACACTTAAGCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059421807 Original CRISPR GGTGCTCCAGGAGGACTTCC TGG (reversed) Intronic