ID: 1059423303

View in Genome Browser
Species Human (GRCh38)
Location 9:114205938-114205960
Sequence GAGGGGGCTTTCCAGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059423293_1059423303 -3 Left 1059423293 9:114205918-114205940 CCTGCTGGGTGGACCCTAAGGAG 0: 1
1: 0
2: 0
3: 9
4: 158
Right 1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG 0: 1
1: 0
2: 2
3: 35
4: 316
1059423290_1059423303 10 Left 1059423290 9:114205905-114205927 CCAAGGAGCTGCACCTGCTGGGT 0: 1
1: 0
2: 4
3: 30
4: 305
Right 1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG 0: 1
1: 0
2: 2
3: 35
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059423303 Original CRISPR GAGGGGGCTTTCCAGGGGAC TGG Intronic
900870662 1:5300060-5300082 CAGGGGGCCTTCCAGGGTACAGG + Intergenic
900997147 1:6128800-6128822 GAGGGAGCGTGGCAGGGGACTGG - Intronic
901454046 1:9353194-9353216 GAGGCGGCTCTCGAGGGGCCGGG - Intronic
901652596 1:10751793-10751815 GAGGAGGCCTCCCAGGGCACAGG + Intronic
901901040 1:12362829-12362851 GAGGGAATTTGCCAGGGGACAGG + Exonic
902392589 1:16115099-16115121 AAGGGGGCTTGGCTGGGGACTGG + Intergenic
902970376 1:20043913-20043935 CAGGGGGCTTTCGAGGTGATTGG + Intronic
903188900 1:21645573-21645595 GAGGGGGTTCTACTGGGGACAGG - Intronic
903448678 1:23438095-23438117 GTGGGGGCTTTTGAGGAGACAGG - Intronic
903448706 1:23438249-23438271 GAGGGGGCTGTCCAGAAGATGGG - Intronic
903621700 1:24702793-24702815 GAGGGGGCTGAGCAGGAGACTGG - Intergenic
904068442 1:27773451-27773473 GCGGGAGCTGTCCCGGGGACAGG + Intronic
905789002 1:40780404-40780426 GAGGGAGCTTTCTTGGGGACAGG - Intergenic
907797387 1:57731295-57731317 GATGGTGGTTTCCAGGGGACAGG + Intronic
907926022 1:58955886-58955908 GAGGGGGGCTTTCAGGGGAAAGG + Intergenic
910343516 1:86214444-86214466 GTGGGGGGCTTCCAGGGGATGGG - Intergenic
911042073 1:93599027-93599049 GATGTGGCTTTCCTGGGGAGTGG - Intronic
911057550 1:93721419-93721441 GGGAGGGCTTCCCAGGGGAGGGG - Intronic
913173637 1:116254694-116254716 GCGGGGGCTTTCCAGGCCATAGG - Intergenic
914676860 1:149912711-149912733 GATGGGAGTTTCCAGGGGACAGG - Intronic
914887022 1:151593850-151593872 GAGGGGGCGGGCCAGGGGAGTGG + Intergenic
916026273 1:160836339-160836361 AAGAGGGCTTTTCAGGAGACTGG + Intronic
916457231 1:164983273-164983295 GAGGAGGCTTTCTGTGGGACCGG - Intergenic
917638507 1:176959688-176959710 GCAGGGGATTTCCAGGGGCCAGG + Intronic
919077053 1:192826240-192826262 GAAGGGGCTATCCTGGGGAATGG - Intergenic
919512278 1:198480234-198480256 TATGGGGCATTCCACGGGACAGG - Intergenic
920081625 1:203378807-203378829 GAGGGGGCTCTGAAGGGGACAGG - Intergenic
920199238 1:204249347-204249369 GAGGGGGGTATCCAGAGGCCAGG - Intronic
921111815 1:212045698-212045720 AAGGGGGCACTCCAGGTGACGGG + Intronic
921936838 1:220803514-220803536 GAGCAGGCTTCCCAGGGGAGGGG - Intronic
922363496 1:224843682-224843704 CAGGGGGCTTCCGAGGTGACGGG + Intergenic
923153585 1:231256358-231256380 GAGGGGCCATTCCTGGAGACAGG - Intronic
924623613 1:245683199-245683221 CAGGGAGCTTTGCAGGGGATGGG + Intronic
1062803648 10:398391-398413 GTGGGGGCCTTCCAGGTCACAGG - Intronic
1063210057 10:3872143-3872165 GGGGTGGCTTCCCAGGGGAGTGG - Intergenic
1063253873 10:4304827-4304849 GATGGGGCTTTGCAGAGGAAAGG - Intergenic
1063713629 10:8505693-8505715 GAGGGGACTGTTCAGGGGACTGG + Intergenic
1063759026 10:9050815-9050837 GAATGGTCTTTCCAGGGGCCAGG + Intergenic
1064643226 10:17435054-17435076 CAGGGGGCTTTCCAGGGGGCTGG - Intronic
1064886948 10:20122390-20122412 TAGGGGGCTTTCGAGGCGATTGG + Intronic
1065704508 10:28459863-28459885 CAGGGGGCTGCCCAAGGGACTGG - Intergenic
1065828025 10:29589426-29589448 CAGGGGACTTGCAAGGGGACTGG - Intronic
1066978944 10:42393318-42393340 GAGGGGGCTTACCTCGGGGCTGG + Intergenic
1067348111 10:45452928-45452950 GAGGGGCCTTTCCCTGGGAAAGG + Intergenic
1067773398 10:49143971-49143993 GAGAGACCTGTCCAGGGGACTGG - Intergenic
1068119656 10:52772639-52772661 GAGGAGGCTTTCTAGGGGTGGGG - Intergenic
1071516043 10:86298610-86298632 GAGGGGCCTTTCCAGGGAGGTGG - Intronic
1071551442 10:86569210-86569232 GAGCGGGCTGTGCAGGAGACTGG + Intergenic
1071791357 10:88957744-88957766 GAGAGGGCTTCCTAGGGGAAGGG - Intronic
1072048338 10:91679378-91679400 CAGGGGGCCTTCTAGGGGATAGG + Intergenic
1073099251 10:100998353-100998375 GAGGGGGCTCTGCTGGGGAGAGG + Intronic
1073157424 10:101358741-101358763 GAAGGGACATTCCAGGAGACAGG + Intronic
1073826125 10:107323653-107323675 GAGGGGATTTTCCAGGGTTCTGG - Intergenic
1076159673 10:128234056-128234078 GAGGAGGCTTTCCAGGTAGCAGG + Intergenic
1076710047 10:132328119-132328141 GAGCGGGCTGTGCAGGAGACCGG + Intronic
1080740774 11:35062706-35062728 TTGGGGGCTTTCCATGGGAAAGG - Intergenic
1081324798 11:41730832-41730854 GAAGGGGCTTTCCAGGTCATAGG + Intergenic
1081488217 11:43547780-43547802 GAGGGGGCTTCCCCGGGGGGGGG + Intergenic
1081517111 11:43843730-43843752 GAGAAGGCTTTCCAGGGCAGGGG - Intronic
1081541584 11:44038499-44038521 GACAGGGCTTTCCAGTGGAGAGG + Intergenic
1082000206 11:47389959-47389981 GAGGGGGCTCCACAGGGGAAGGG - Intergenic
1083184021 11:61007275-61007297 GAGGAGGGTTTCTAGGGGGCTGG + Intronic
1083271170 11:61573307-61573329 GAGGGGGCTTCCCAGGTGCCTGG - Intronic
1083309698 11:61777914-61777936 GAGTAGGATTTCCAGGTGACAGG - Intronic
1083959445 11:66006488-66006510 GTGGGGGCTTTGCAGGGCTCCGG + Intergenic
1084527169 11:69704523-69704545 GAGTGGGCTTTTAAGGGGAAGGG - Exonic
1084927899 11:72528395-72528417 AAAGGGGCTTTCCAGAGGCCTGG + Intergenic
1085516798 11:77116337-77116359 GAGGGGGCTTCCCACGGGCCTGG + Intronic
1085641812 11:78197492-78197514 GATGAGGCTCTCCAGGGGAAAGG + Intronic
1088213100 11:107478028-107478050 GAGCCAGCTCTCCAGGGGACAGG + Intergenic
1089045396 11:115497813-115497835 GAGGGGGCGGTGCAGGGGGCAGG + Intronic
1089786859 11:120913771-120913793 GAGGGAGCTTCCCAGAGGCCTGG + Intronic
1089901273 11:121988320-121988342 GAGGGAACATCCCAGGGGACAGG + Intergenic
1090248027 11:125230559-125230581 CAGAGGGCTTTGCAGAGGACAGG + Intronic
1094452966 12:30601603-30601625 GAGGGGGCACTCCAGGTGCCTGG - Intergenic
1101940756 12:109097752-109097774 GAGCCGGCCGTCCAGGGGACCGG + Exonic
1102853799 12:116277017-116277039 GAGGGGGCTGTGCCGGGGAAGGG - Intronic
1102974851 12:117199234-117199256 GAGGGATCTTTCCAAGGGAGGGG + Intergenic
1104030233 12:125059736-125059758 GAGGGGGCCTGCCAGGTCACAGG + Intergenic
1104030779 12:125064670-125064692 GAGGGGGCCTTCCAGGTCATAGG + Intergenic
1104450368 12:128864036-128864058 TAGGGGGACTTCCAGGGGCCTGG + Intronic
1111125992 13:83911508-83911530 TAGGGGGCTTCCCAGGCGATCGG + Intergenic
1117345019 14:54823124-54823146 GAGGGGGCTCCCCAGAGGTCTGG + Intergenic
1117553133 14:56856263-56856285 GAGGGTGCTTTCTCGGGGGCTGG - Intergenic
1117615243 14:57527848-57527870 GAAATGGCTTTCCTGGGGACCGG + Intergenic
1119344441 14:73910903-73910925 AAGGGGGCTTTCCAGTTGTCAGG + Intronic
1122414377 14:101541863-101541885 GAGGGGGCTGGCCTGGGGAGGGG - Intergenic
1123028874 14:105441245-105441267 GGGGGGGCCCACCAGGGGACAGG - Intronic
1124400551 15:29344191-29344213 GGGGAGACTTTCCAGGGAACAGG + Intronic
1126096312 15:45093368-45093390 GAGGGGCCTGCCCAGGGGTCAGG + Exonic
1126575046 15:50188234-50188256 GAGGGGGCATTCCAGGCAAAAGG + Intronic
1126800806 15:52295370-52295392 GAGGGGGCTTACCCGCGGGCAGG + Intronic
1128081997 15:64862299-64862321 GAGGCGGCTTTCCAGGCCCCTGG + Intronic
1129465972 15:75724378-75724400 GAAGGGGCTTTGCAGGAGGCAGG - Intronic
1129607033 15:77030029-77030051 GAGAGGCCTTCCCAGGGGAAGGG - Intronic
1129709633 15:77813984-77814006 GGGGGGGCTTCCTAGGGGGCAGG - Intronic
1129933620 15:79431949-79431971 GAGGGGGCGGTCCCGGGGAGGGG - Intergenic
1130151641 15:81315857-81315879 GAGGGTGAACTCCAGGGGACAGG - Intronic
1130350336 15:83085649-83085671 TAGGGGGCTCTCCAGAGCACAGG + Intergenic
1131265251 15:90911682-90911704 GAGGGGGTTGTCCAGAAGACAGG + Intronic
1131442340 15:92468403-92468425 AAGGGAGCATTCCAGGGGATGGG - Exonic
1131445734 15:92496804-92496826 GACAGGGCTTCCCCGGGGACGGG - Intronic
1132789722 16:1678693-1678715 GTGGGGGGTTTCCTGGGGGCGGG + Intronic
1133774971 16:8889039-8889061 CTGGGGGTATTCCAGGGGACTGG - Intergenic
1133968001 16:10545764-10545786 GAGGGGGCATTGCAGGGGGATGG - Intronic
1135727133 16:24863916-24863938 GGTGGGGCTTTCCAGGGAACAGG - Intronic
1136068236 16:27772752-27772774 GAGGGTGCTCTCCAGGGAGCAGG - Intronic
1136419477 16:30123015-30123037 GAGGGGGCGTTCCGGGGGAGGGG - Intronic
1137510179 16:49092797-49092819 GAGGGGGCATACCATGGCACAGG + Intergenic
1137776268 16:51056796-51056818 GAGAGGACATTCCAGGAGACAGG + Intergenic
1138516391 16:57537291-57537313 TCGGGGGCCTTCCAGGGTACAGG - Intergenic
1139222883 16:65202466-65202488 AAGGGTGCTTACCAGGGGAGTGG + Intergenic
1139333181 16:66210135-66210157 GAGGGGTCATTTCAGGGGAGGGG - Intergenic
1141136350 16:81468168-81468190 GAGCGGGCTTTCCTGGGCAGGGG + Intronic
1141280588 16:82627210-82627232 GAGGGGGCTTTCGGGGGGTCGGG + Intronic
1142021078 16:87783008-87783030 GAGGGGGGCTTCCAGGTGGCAGG + Intergenic
1142075913 16:88117699-88117721 GAGGGGCTTTTCCTGGGGAAGGG + Intronic
1142512426 17:405111-405133 CAGGGAGCTTGCCAGGGGATGGG + Intergenic
1142748392 17:1972533-1972555 GAGAGGGCGTTGCAGGGGAGGGG - Intronic
1143949028 17:10618407-10618429 GAGAGGGTTTTCCAGAGCACAGG + Intergenic
1144835587 17:18155053-18155075 GATGGGGGTTGCCAGGGGAGTGG + Intronic
1145879159 17:28341362-28341384 GAGGGGCCAGGCCAGGGGACTGG - Intronic
1146521415 17:33528337-33528359 GAGGGAGAGTTCCAGGGGTCTGG - Intronic
1146716138 17:35088879-35088901 GAGGGGACTTTTCAAAGGACAGG + Intronic
1147185462 17:38711031-38711053 GAGGGGGCCTTGCAGGGTATGGG + Intronic
1147335889 17:39726834-39726856 GAAGGTGCTGTCCAAGGGACTGG - Exonic
1147898910 17:43770730-43770752 GGGGGTGCTTTCCAGGGTGCTGG + Intronic
1148865925 17:50628573-50628595 GAGGGGGCTGTTCAAGGGAGTGG - Intergenic
1151790845 17:76304837-76304859 GAAAGGGCTCTCCAGGGGGCTGG - Intronic
1152026653 17:77814040-77814062 GAGGGGGCTACTCAGGGCACGGG - Intergenic
1152244753 17:79179518-79179540 GAGGGGGCTGGCCGGGGGAGAGG - Intronic
1153223351 18:2880520-2880542 GACGGGGCTCTCCAGAGGGCTGG + Intronic
1154154927 18:11936605-11936627 GAGGGCGCTTCCCAGGGGAGGGG + Intergenic
1155519703 18:26656483-26656505 GAGGGGGCTTTAAAGGCGCCTGG + Intronic
1156484696 18:37457338-37457360 GAGGGGGCTTTCAGGAGGACTGG - Intronic
1157725268 18:49959118-49959140 GAGGGGGTGTTCCAGGTGAAGGG - Intronic
1160230444 18:77044511-77044533 GAGAGGGCTTTCCAGGGACGAGG - Intronic
1161090894 19:2359805-2359827 GAGGGCGTTTTCTAGGGCACTGG - Intergenic
1161091013 19:2360138-2360160 GAAGGGGCTTGGCAGGGGGCCGG + Intergenic
1161293198 19:3506603-3506625 GAGGCGGCATTCGAGGGGACTGG - Intronic
1161398974 19:4059274-4059296 GAGGTGTCTTTCCTGGGGCCTGG + Intronic
1161487286 19:4543171-4543193 GAGGGACCTTTCCAGGGGTGGGG + Exonic
1161694394 19:5757962-5757984 GAGGGGGCCTCTCAAGGGACAGG - Intronic
1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG + Intronic
1163015240 19:14450718-14450740 GAGGGGCCTCTCCAAGGGGCGGG + Intronic
1163196708 19:15726893-15726915 GAGCTGGCTCTGCAGGGGACTGG + Intergenic
1163255948 19:16155948-16155970 GAAGGGGCTTTCCTGGGCACTGG + Intronic
1164926843 19:32137368-32137390 CAGGGAGCTTTCTAGAGGACTGG + Intergenic
1165435304 19:35791889-35791911 GAGGGGGCTTTCCCTGGGAGGGG + Intergenic
1165758574 19:38308002-38308024 GAGAGGGCTTCCCAGGAGAGGGG + Intronic
1166060492 19:40322523-40322545 GATGGGGGAGTCCAGGGGACTGG + Intronic
1166568167 19:43777731-43777753 GAGAGGGATTTAGAGGGGACTGG + Intronic
1166821666 19:45584298-45584320 GACGGGGCTTTCCAGGATAGAGG - Intronic
1167116504 19:47492090-47492112 GAGGGGGCTGTCCATGGCATTGG + Exonic
1167609686 19:50501191-50501213 GAGGGGGTTAGCCAGGGGCCCGG + Intergenic
1167636856 19:50660168-50660190 GAGGGGGCTTTTCAGGGGGAGGG + Intronic
1168295171 19:55374609-55374631 GAGGGGGCTCTGCAGGGGGCCGG - Intergenic
925451495 2:3973265-3973287 GTGGGAGCTTTCCAGGGCAAGGG + Intergenic
925856317 2:8133069-8133091 GAGTGGGCTGTCCATGGGAAAGG - Intergenic
927419198 2:22912378-22912400 ATGGGGGCTTTCCTGGGGATAGG + Intergenic
927465533 2:23333660-23333682 GAGGGTGCATACCAGGGGAGAGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929260206 2:39858843-39858865 GAAGGAGCTTTCCAGGGTGCTGG - Intergenic
930127639 2:47815297-47815319 GAGGGGGATACCCAGGGGAAGGG - Intronic
932595889 2:73093254-73093276 GAGGGAGCTTCCCAGAGGAGTGG - Intronic
933980871 2:87549799-87549821 GGAGGGGCTTCCCAGAGGACAGG + Intergenic
934117846 2:88813008-88813030 CAGGGGGCCTTGCTGGGGACAGG + Intergenic
935258934 2:101338028-101338050 GAACGGGCTTGCCAGGGGAAGGG - Intergenic
935830170 2:106994090-106994112 GAGGAGGCTTCCCAGGGTACAGG + Intergenic
936008199 2:108908497-108908519 GAGGGGGCTTTCCAGGCACAAGG - Intronic
936111532 2:109669871-109669893 GGGGGTGCTATCCAGGGCACGGG - Intergenic
936312959 2:111400986-111401008 GGAGGGGCTTCCCAGAGGACAGG - Intergenic
936572086 2:113625924-113625946 GAGGGGGCTTCCAAGGTCACAGG - Intergenic
937213472 2:120294078-120294100 GAGGGGCCTAACCAGAGGACAGG - Exonic
937280745 2:120715802-120715824 CAGGGAGCTTTCCAGGGGAGGGG + Intergenic
938639325 2:133264034-133264056 GTGGAGGCTTTCCAGGGCTCTGG - Intronic
938842196 2:135174339-135174361 GAGGGGCCATTCCAGAGCACAGG - Intronic
939745160 2:145958541-145958563 GAGGTGGCTTCCCAGGGAACTGG + Intergenic
941665627 2:168241571-168241593 GAAGGGGCTTACAAGGGGAGAGG - Intronic
944893854 2:204144339-204144361 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
945138594 2:206658616-206658638 CTGGGGGCTGTCCAAGGGACTGG - Intronic
945868762 2:215204557-215204579 GGGGGGGATTTCCAGGTTACAGG - Intergenic
946414079 2:219530695-219530717 GCGGGGGCATTCCAGGAGAGGGG + Intronic
947452535 2:230221717-230221739 GAAGGGGCTTTCCAGGTGATGGG - Intronic
947525212 2:230873358-230873380 AGGGGGGATTTCCAGGGGAGGGG + Intronic
947670009 2:231929965-231929987 GAGGGGCCCTTCCTTGGGACAGG + Intergenic
947705698 2:232273732-232273754 GAAGGGGCACTCCAGGGGAAGGG + Intronic
947741033 2:232485103-232485125 GAGGGGGCTCACCCAGGGACAGG + Intronic
948129065 2:235586836-235586858 GAGGGAGCTTTCTTGAGGACGGG + Intronic
948272956 2:236688002-236688024 GAGGGGGCCTCCCTGGGGACGGG + Intergenic
1168970153 20:1925433-1925455 GAGGGGGCTTTCTAGGGAGGTGG - Intronic
1170562478 20:17569610-17569632 GAGGGGGATTTGGAGGGGAGAGG - Intergenic
1170693193 20:18633643-18633665 GAGTGGGCCTCCCAGGGGACCGG + Intronic
1170805668 20:19628582-19628604 GGGGGTGCTTCTCAGGGGACTGG + Intronic
1171891613 20:30723567-30723589 GATGGGGCCTTGCAGGGCACCGG - Intronic
1171959150 20:31481426-31481448 GCGAGGGCTTCACAGGGGACTGG - Intronic
1172127518 20:32633767-32633789 GAGGGGGCTGTCAGGGCGACTGG - Intergenic
1174180815 20:48673187-48673209 CATGGGGCTTTCCAGCGGATGGG - Intronic
1175470727 20:59225604-59225626 TAGATGGTTTTCCAGGGGACAGG + Intronic
1175694159 20:61088790-61088812 GAGAGGGGTTTCCAGGAGACTGG - Intergenic
1175974160 20:62702042-62702064 GAGGTGGGTGTCCAGGAGACCGG - Intergenic
1177197348 21:17917390-17917412 GAGGGGACTTACCAGGGAATTGG - Intronic
1177831985 21:26149283-26149305 GAGGGAGCTGGCCAGTGGACTGG - Intronic
1179786683 21:43734224-43734246 GACGGGGCTTTCGTGTGGACGGG + Intronic
1179925687 21:44533032-44533054 CAGGGGACTTGGCAGGGGACCGG - Intronic
1180170304 21:46054990-46055012 GAGGGGGCTGTGCAGGGCAGAGG - Intergenic
1180219057 21:46346456-46346478 GAGGGGGCTTCGCAGCTGACAGG - Intronic
1180246642 21:46552946-46552968 GAGGGGGCTTTGAATGGAACTGG + Intronic
1180918242 22:19504602-19504624 GCTGGGGCTTTTAAGGGGACTGG + Intronic
1180933174 22:19607248-19607270 GAGGGAGCTTCCCAGAGCACCGG - Intergenic
1180985076 22:19899309-19899331 CCGGGTGCCTTCCAGGGGACAGG - Intronic
1181581678 22:23832246-23832268 GAGGGAGCTTCCTAGGGGCCAGG - Intronic
1181925964 22:26358879-26358901 GTGGGGGCTGTCCTGGGCACTGG - Intronic
1182521363 22:30886264-30886286 GAGGGGGCCTTCCAGGCTATAGG + Intronic
1182696205 22:32200758-32200780 AAGAGGGCATTCCAGGGGTCAGG - Intronic
1182715902 22:32356139-32356161 AAGAGGGCATTCCAGGGGCCAGG + Intronic
1183374825 22:37457125-37457147 AATGGGGCTCTCCTGGGGACTGG - Intergenic
1183732881 22:39628371-39628393 GAGGAGGCTTCCCAGAGGAGGGG + Intronic
1184983818 22:48115514-48115536 GAGGCTGCTTCCCATGGGACAGG + Intergenic
1185428105 22:50784956-50784978 GAGGGGGCTTCCAAGGTCACAGG + Intergenic
949115488 3:316094-316116 GAATGGGCTTTCCAGTTGACCGG + Intronic
949877929 3:8638817-8638839 GGGGGGCCATCCCAGGGGACAGG - Intronic
952963367 3:38606552-38606574 GTGGGAGCTTTGGAGGGGACAGG - Intronic
953683473 3:45057870-45057892 AAGGGGGGTTTCCAGGTCACAGG + Intergenic
954379800 3:50213417-50213439 CAGGGGGCCTTCCAGGAAACGGG - Intronic
954425512 3:50440893-50440915 GGGAGGGCTTTCCAGGGGAGAGG + Intronic
956711571 3:72042686-72042708 GAGGGGAGGTTCCAGGGGGCAGG + Intergenic
958151292 3:89697507-89697529 GAGGCGGCTGTACAGGAGACTGG + Intergenic
960354963 3:116640325-116640347 TAGAGGACTTTCCAGGGGAGGGG - Intronic
960623034 3:119654497-119654519 GAGGGGGTGTTCCAGGTAACAGG - Exonic
961075342 3:123976947-123976969 GAGGCGTCTCTCCACGGGACAGG + Exonic
961308346 3:125975575-125975597 GAGGCGTCTCTCCACGGGACAGG - Exonic
961810718 3:129520066-129520088 GAGGGGGCTTGGCAGTGGTCAGG - Intronic
962201420 3:133403788-133403810 GTGGGGAGATTCCAGGGGACAGG - Intronic
964219592 3:154328122-154328144 GAGGGAGTTTTCCAGGTCACAGG - Intergenic
965757272 3:172039833-172039855 GCCGGGGCTTTCCAGTGCACCGG - Intronic
967087599 3:186108915-186108937 GAGGGGGCTTTGCGGGGGCAGGG - Intronic
967282670 3:187837177-187837199 TAGTGGGCTTCCCAGGGGAATGG + Intergenic
968519878 4:1030429-1030451 GAAGGGGCTCTCCTGGGGGCTGG + Intergenic
968585716 4:1415026-1415048 GCCGAGGCTTTGCAGGGGACGGG - Intergenic
972193064 4:36617994-36618016 GAGAAGGCTTCCCAGAGGACTGG + Intergenic
973246164 4:48013513-48013535 GACGGGGCTTTCCAGGTCATAGG + Intronic
976696585 4:87924347-87924369 TAGGGGGCTTTCGAGGCGATCGG - Intergenic
977610589 4:99025955-99025977 GAAGGAGCCTTCCAGGTGACAGG - Intronic
980270455 4:130577224-130577246 GAGGTGGCTGTGCAGGAGACTGG - Intergenic
985389823 4:189482691-189482713 GAGGGGGCTTCCGAGGTGATCGG + Intergenic
990705990 5:58530469-58530491 GAGGGGGCCTTCCAGGTCATAGG + Intergenic
997375934 5:133397620-133397642 GAGGGGGTTCTCCTGAGGACTGG - Intronic
997466028 5:134088715-134088737 GTGGGACATTTCCAGGGGACAGG - Intergenic
997594046 5:135094660-135094682 AAGGGAGCTTTCCATGGGAGGGG - Intronic
997849515 5:137318485-137318507 GAGAGGGATTCCCAGGAGACTGG - Intronic
998558513 5:143149183-143149205 TGGGGGGCTTTCCTGGGGAAGGG + Intronic
999238593 5:150114540-150114562 CTGGGGGCTTTCCAGGACACCGG + Exonic
1001587698 5:172844648-172844670 GAGGGGGCTTAGCATGGGATGGG - Intronic
1001642885 5:173257681-173257703 GAGGCTGCTTTCCAAGGCACTGG - Intergenic
1002161666 5:177317663-177317685 CAGGCGGCTTTCAAGGTGACAGG - Intergenic
1002168503 5:177362501-177362523 GAAGGGGCATTCAAGGGGCCTGG + Intronic
1002662675 5:180802543-180802565 GAGGGGGCTTGGCTGGGGAGCGG - Intronic
1002689283 5:181038967-181038989 GAGGGGCCTCTGCAGGTGACAGG - Intergenic
1003311393 6:4972498-4972520 AACGGGGGTTGCCAGGGGACGGG + Intergenic
1004462905 6:15854981-15855003 GAGGGGGATCCCCTGGGGACTGG - Intergenic
1005823941 6:29621028-29621050 GAGGGGGCCTTGCAGGGGAAAGG - Intronic
1005954885 6:30656858-30656880 GTGGGGGCTTCCTAGGGAACCGG - Intronic
1006171393 6:32095443-32095465 GGTGGGGCTTTCCAGTGGGCAGG - Intronic
1006597589 6:35204713-35204735 GTGAGGGCTTTCCAGGTGGCAGG - Intergenic
1007616344 6:43181938-43181960 GAGGGGGCTTCACAGTTGACTGG + Intergenic
1008479108 6:51966298-51966320 GAGGGGGACTTCCAGGTCACAGG + Intronic
1010606984 6:77902762-77902784 GAGGGGGCTTTCCATGTCATAGG - Intronic
1012704313 6:102501787-102501809 GATGGTGATTTCCAGGGGCCAGG - Intergenic
1015266783 6:131297934-131297956 TAGGGGGCTTCCGAGGGGATCGG - Intergenic
1015287998 6:131507512-131507534 TAGGGGGCTTCCGAGGGGATCGG + Intergenic
1016840614 6:148520636-148520658 GAGAGGGGCTTCCAGGGTACAGG + Intronic
1017666234 6:156722514-156722536 GTGGGGGCATCCCAGGGGTCTGG - Intergenic
1018091125 6:160347883-160347905 GAGGGGGCTCTCCCGGGCACAGG + Intergenic
1018620772 6:165727408-165727430 GAGGAGGCTTTCCAGGAGCCTGG + Intronic
1018905823 6:168075376-168075398 GAGGTGGCCTCCCTGGGGACAGG - Intronic
1019263281 7:94522-94544 CAGGGGGCTGCCCATGGGACTGG + Intergenic
1019483417 7:1276611-1276633 AAGGGGGCCTTCTAGGGGGCTGG - Intergenic
1020086184 7:5312159-5312181 GAAGGGGCTTTCCAGGCCTCTGG - Intronic
1021838563 7:24704312-24704334 GAGGAAGCTTCCCAGGAGACAGG + Intronic
1022248801 7:28586462-28586484 AAGGGGGCTGTCCAGAGGCCTGG - Intronic
1022753248 7:33254672-33254694 CAGGGTGCTTACCAGGGGTCAGG - Intronic
1023189434 7:37563656-37563678 GAGGGGGTTTTCCAGCAGAAGGG + Intergenic
1024045131 7:45580618-45580640 GAGGCGGCTTCCCTGTGGACTGG + Intronic
1024147874 7:46535678-46535700 GAGGTGGCTTTCAAGGGGAAAGG - Intergenic
1025035725 7:55591562-55591584 GTGGGGGCCTCCCAGGGGAAGGG - Intergenic
1025208119 7:57004915-57004937 GAAGGGGCTTTCCAGGCCTCTGG + Intergenic
1025663835 7:63571960-63571982 GAAGGGGCTTTCCAGGCCTCTGG - Intergenic
1026788457 7:73316823-73316845 GAAGGGGCTGTGCAGGGGAGGGG - Intronic
1027141897 7:75663525-75663547 CAGGGTGTTTGCCAGGGGACAGG + Intronic
1029650378 7:101887145-101887167 GAAGGGGCTTTGCTGGGGAGGGG + Intronic
1029699200 7:102235403-102235425 GAGTGGGCATCCCAGGGGCCGGG + Intronic
1030190829 7:106808600-106808622 GTGGGGGCCTTCCAGGTCACAGG + Intergenic
1032577712 7:133073167-133073189 GGGAGGGCTTTCCAGAAGACGGG - Intronic
1033813487 7:145045335-145045357 GACTGGGCTCTCCAGGGCACTGG - Intergenic
1034424464 7:151007306-151007328 GAGGAGGCATCCCAGGGGGCAGG - Intronic
1034461369 7:151199704-151199726 GAGGGGGCTGGGCTGGGGACTGG - Intronic
1035063121 7:156084104-156084126 AAGGGTGCTTACCAGGGGCCAGG - Intergenic
1035354860 7:158270802-158270824 GAGGGGGCGGTCCAGGTGAGGGG - Intronic
1035737252 8:1897937-1897959 GAGGGGGCTGTGCAGTGGAGAGG - Intronic
1036755125 8:11466586-11466608 GCGGGGACTTTCCCAGGGACTGG - Intronic
1037336856 8:17800936-17800958 GAGGGGGCGTTCCAGGGGCCTGG - Intergenic
1037959270 8:23084148-23084170 GAGCGGGCTCTCCAGGGCAAGGG - Intergenic
1038432134 8:27508920-27508942 GATGGGGGTTGCCAGGGGCCAGG - Intronic
1038432149 8:27509041-27509063 GATGGGGGTTGCCAGGGGCCAGG - Intronic
1038700966 8:29848981-29849003 GAGTGAGCTTTGGAGGGGACAGG + Intergenic
1039463725 8:37767317-37767339 GAGAGGGATTACCAAGGGACAGG - Intronic
1040018109 8:42716708-42716730 GAGGCGGCTTTCCATAAGACAGG - Intronic
1040960488 8:53027135-53027157 GGGAGGGCTTCCCAGGGGTCTGG + Intergenic
1041097763 8:54366352-54366374 GAGGGAGCTTTTCAGTGGTCAGG - Intergenic
1042453604 8:68975653-68975675 TAGGGGGCTTCCGAGGGGATTGG - Intergenic
1042605938 8:70546622-70546644 GAGGGGGTTTTCCATGTGAGTGG + Intergenic
1047491246 8:125376520-125376542 GAGGGAGGTTACCAGGGGTCTGG - Intergenic
1047802388 8:128323512-128323534 GAGAGGGATTTGCAGGTGACAGG - Intergenic
1048116758 8:131532209-131532231 TGGGGGGCTTTGCAGGGTACAGG - Intergenic
1048296145 8:133215595-133215617 AAGGGGGTTTTCCAGGCCACCGG - Intronic
1048535359 8:135289269-135289291 GAGGTGGCTTTCCCTAGGACAGG - Intergenic
1048983573 8:139716547-139716569 GGGGGAGCTTGCCTGGGGACAGG - Intergenic
1049194748 8:141308806-141308828 GAGGGTGCTTGCCAAGGGGCTGG - Intergenic
1049703036 8:144023660-144023682 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1049703270 8:144024470-144024492 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1049747323 8:144268588-144268610 GTGGGGGCTTCCCAGGGAGCCGG - Intronic
1049859641 8:144889861-144889883 GTGGGGGCTTCTCAGGGTACGGG - Intronic
1050083308 9:1938319-1938341 AAGGGAGGTCTCCAGGGGACAGG + Intergenic
1051659671 9:19414155-19414177 GAGGGGGCTTCCCAAGGCATGGG - Intronic
1055161998 9:73141859-73141881 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
1056880269 9:90384834-90384856 GAGGGGGATTTCCATGGGGCTGG - Intergenic
1056935119 9:90910578-90910600 GCTGGGGCCTTCCAGGGGACTGG + Intergenic
1057221977 9:93262316-93262338 GAGGATGCTTTCCCTGGGACAGG + Intronic
1057286711 9:93762002-93762024 AAGGGAGCTTTCCAGGGTGCTGG - Intergenic
1057550469 9:96048291-96048313 GAGGGGGGTTTCCAGGGCTTAGG - Intergenic
1057571045 9:96204358-96204380 GAAGGGGCTCTCCAGGGCCCGGG + Intergenic
1058176265 9:101738790-101738812 GAGAGGACTTTCCAGGGGCGCGG - Intergenic
1058245230 9:102615155-102615177 GAGGGGGGCTTCCAGGACACAGG - Intergenic
1058370269 9:104258536-104258558 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
1058603994 9:106701548-106701570 GAGAGGGCTTTTCAGGGCAATGG - Intergenic
1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG + Intronic
1059463220 9:114448624-114448646 AGGGGGGCTTTCCAGGGGATAGG - Intronic
1060726930 9:126012299-126012321 AAGGGGGCTGTCCAGGGAAGGGG - Intergenic
1060809639 9:126604090-126604112 AAGAGGGCTTTCCAGGTGAAGGG + Intergenic
1061164173 9:128912856-128912878 GAGGGGGAATTCAAAGGGACGGG + Intronic
1061390779 9:130316046-130316068 GAGGGGACTTCCCAGGGCACAGG - Intronic
1061941217 9:133885088-133885110 GAGGGTTCTCTCCAGAGGACTGG + Intronic
1062157260 9:135059395-135059417 GGAGGGGCTTTCTCGGGGACTGG + Intergenic
1185719000 X:2366941-2366963 GAGTCAGCTTTCCAGGGGGCTGG - Intronic
1186790301 X:12990925-12990947 GAGGGGGCTTTCCAGGATGAGGG - Intergenic
1187280445 X:17854720-17854742 GAGGAGCTTTTCCAGGGAACTGG + Intronic
1187551463 X:20310160-20310182 GATGCGGCTTTCCAGGGGAAAGG + Intergenic
1187736244 X:22306846-22306868 GAGTGGGTATTCCAAGGGACAGG - Intergenic
1187841319 X:23491905-23491927 GAGCTGGCTGTCCAGGAGACTGG - Intergenic
1188003978 X:25005083-25005105 GAGAGGGCTTTCCTGGGGCAGGG + Intronic
1191155356 X:57267097-57267119 GCTGGAGCTTTCCATGGGACAGG - Intergenic
1197754505 X:129984314-129984336 GAGGGGGCCGTCCTGGGGGCGGG + Intronic
1199743473 X:150757230-150757252 GAGGGAGCTTTCCAGCTGGCAGG - Intronic