ID: 1059423721

View in Genome Browser
Species Human (GRCh38)
Location 9:114207963-114207985
Sequence CTCAAACAAGCAACCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059423721_1059423728 17 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG No data
Right 1059423728 9:114208003-114208025 GTGGTTAGGAGCCCAGGCCCAGG No data
1059423721_1059423727 11 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG No data
Right 1059423727 9:114207997-114208019 TGCAGAGTGGTTAGGAGCCCAGG No data
1059423721_1059423725 -2 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG No data
Right 1059423725 9:114207984-114208006 AGGAGAGGCAGTATGCAGAGTGG No data
1059423721_1059423726 3 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG No data
Right 1059423726 9:114207989-114208011 AGGCAGTATGCAGAGTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059423721 Original CRISPR CTCAAACAAGCAACCAATGG AGG (reversed) Intronic