ID: 1059423721

View in Genome Browser
Species Human (GRCh38)
Location 9:114207963-114207985
Sequence CTCAAACAAGCAACCAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059423721_1059423727 11 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1059423727 9:114207997-114208019 TGCAGAGTGGTTAGGAGCCCAGG No data
1059423721_1059423725 -2 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1059423725 9:114207984-114208006 AGGAGAGGCAGTATGCAGAGTGG No data
1059423721_1059423728 17 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1059423728 9:114208003-114208025 GTGGTTAGGAGCCCAGGCCCAGG No data
1059423721_1059423726 3 Left 1059423721 9:114207963-114207985 CCTCCATTGGTTGCTTGTTTGAG 0: 1
1: 0
2: 2
3: 10
4: 140
Right 1059423726 9:114207989-114208011 AGGCAGTATGCAGAGTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059423721 Original CRISPR CTCAAACAAGCAACCAATGG AGG (reversed) Intronic
902986143 1:20155423-20155445 CTCAAACAGGCTGCCAAGGGAGG - Intergenic
908041007 1:60113207-60113229 CTCAAAGTATCCACCAATGGAGG - Intergenic
908659696 1:66423189-66423211 CTCAGACAAACAAACCATGGTGG - Intergenic
909043492 1:70682289-70682311 AGCAAAGAAGCAACCAATAGAGG - Intergenic
909939092 1:81589981-81590003 CTCTAACAAGCGGCCCATGGTGG + Intronic
911816814 1:102363208-102363230 CTCAATCAAGCAGTCCATGGAGG - Intergenic
911979982 1:104555210-104555232 CTGACAAAAGCAAGCAATGGGGG + Intergenic
918922094 1:190726132-190726154 CTCAAACAAGTAAAAAATGAGGG - Intergenic
919309308 1:195886956-195886978 CTCAAACAAGATCCCAATGTAGG - Intergenic
920250672 1:204620274-204620296 CTCAAACAAACAAACACGGGAGG - Exonic
923782063 1:237033452-237033474 CTGAACCAAGCACCCATTGGTGG + Intergenic
1066614502 10:37281693-37281715 CTCAGACAAGCAAACCTTGGTGG - Intronic
1069137265 10:64781862-64781884 CTCAGACAAACAAACATTGGTGG - Intergenic
1070601042 10:77866422-77866444 CACAAACAAGCAGCCAACTGTGG + Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1075146403 10:119886435-119886457 CTCAAACAAACAAACCTTGGTGG + Intronic
1076660992 10:132056062-132056084 CACAAACAAGCAGGCAATGCTGG - Intergenic
1076664017 10:132075815-132075837 CTCAAAACAGCAAAAAATGGGGG - Intergenic
1080933199 11:36835564-36835586 CTCAAACAAGCAAGCACTAAGGG - Intergenic
1081769660 11:45641486-45641508 CACAAATAAGAAACCAAAGGAGG + Intergenic
1084631647 11:70355737-70355759 GCCAAACAAGCGGCCAATGGAGG - Exonic
1089463000 11:118663673-118663695 CTCAAATTAGCAACCAGTGTGGG - Intronic
1089778148 11:120853648-120853670 CACAAACAGGGAACCAAGGGAGG + Intronic
1091048561 11:132347749-132347771 CTTCAACAAGCATCCAGTGGGGG + Intergenic
1091049948 11:132358385-132358407 CTGAAACAACCAACCAACTGTGG + Intergenic
1092472391 12:8791216-8791238 CTCAGACAAGCAAACCTTGGTGG + Intergenic
1097135374 12:56848870-56848892 CTCACAAAAACAAGCAATGGAGG - Intergenic
1098712966 12:73790423-73790445 CTCAAACAAACAAAAATTGGGGG - Intergenic
1099160329 12:79233392-79233414 CTCACACAAGTACCCACTGGAGG - Intronic
1100271122 12:93025855-93025877 CTCAATCAATCAATCAATGTGGG - Intergenic
1104322281 12:127762906-127762928 CTGAAACGTGCAACCAATTGAGG - Intergenic
1108822832 13:54374810-54374832 CCTGATCAAGCAACCAATGGTGG + Intergenic
1111686732 13:91511548-91511570 CTCAAAGAAGAAAACAATGCTGG - Intronic
1115943500 14:38634847-38634869 CTCACAAAAACAAGCAATGGGGG + Intergenic
1116260302 14:42615895-42615917 CTCAAACAAGCTTCCCATGTTGG + Intergenic
1118908971 14:70045753-70045775 CTTAATCAATCAAACAATGGAGG - Exonic
1131472232 15:92707474-92707496 CTCAAACAAAGAACCCATGAAGG - Intronic
1133013359 16:2927128-2927150 ATCGTACAAGCAACCCATGGCGG + Intronic
1133363642 16:5193867-5193889 CACAAAAAAGCAAAGAATGGTGG - Intergenic
1134133234 16:11663824-11663846 CTCAAAAAAAAAAGCAATGGGGG + Intergenic
1134566696 16:15257756-15257778 CTCAAACAAACAAAAAAAGGGGG + Intergenic
1134735800 16:16498943-16498965 CTCAAACAAACAAAAAAAGGGGG - Intergenic
1137444099 16:48521521-48521543 TGGAAACAAGCAATCAATGGAGG - Intergenic
1137899356 16:52247912-52247934 CTCAGACAAGCAAACACTGAGGG + Intergenic
1141098379 16:81179112-81179134 CTCAAACACACAAACAATGGAGG - Intergenic
1141221567 16:82074078-82074100 CTGAAAAAAACAAGCAATGGGGG + Intronic
1145866486 17:28245334-28245356 CTCATGCAACCAGCCAATGGCGG + Intergenic
1146861755 17:36308089-36308111 CCCAAACAAGCAAACAATATAGG - Intronic
1147092083 17:38112193-38112215 CCCAAACAAGCAAACAATATAGG - Intergenic
1147105126 17:38208306-38208328 CCCAAACAAGCAAACAATATAGG + Intergenic
1148424374 17:47580173-47580195 CCCAAACAAGCAAACAATATAGG - Intronic
1149423671 17:56534403-56534425 ATCAAACAAACAAAAAATGGCGG - Intergenic
1155127544 18:22894124-22894146 CTGACACAAACAAGCAATGGGGG + Intronic
1157094767 18:44678451-44678473 CTCAAACCAGCAGCCAATGCAGG + Intergenic
1157588740 18:48822010-48822032 TTCAAAGAAGCAACGAATAGTGG - Intronic
1157837196 18:50915842-50915864 CTAAAGCAAGCCACCAATGCAGG - Intronic
1162645349 19:12045644-12045666 CTCAAACAAACAAACAAAGATGG + Intronic
1166527749 19:43523645-43523667 CTCAGACAAGCCAGCCATGGTGG + Intronic
931089090 2:58866563-58866585 ATCAAACAAGAAATAAATGGGGG - Intergenic
932144421 2:69305826-69305848 CTCAGACAAGCTGCCAGTGGGGG + Intergenic
935362704 2:102261168-102261190 CTCAAACCAGCAAACATGGGTGG + Intergenic
939048016 2:137272571-137272593 ATCCAAGAAGCAGCCAATGGAGG + Exonic
942795821 2:179817984-179818006 CTCAAACAAGCAACCATGTATGG + Intronic
943857512 2:192816389-192816411 ATTAAACAAGCAGCCCATGGTGG + Intergenic
945860781 2:215119569-215119591 CTCACAAAACCAAGCAATGGGGG - Intronic
947594494 2:231402315-231402337 CTTAAACAAGCTGCCAAGGGAGG - Intergenic
948746078 2:240095409-240095431 TTCAAAGAAGCTCCCAATGGGGG + Intergenic
1168860178 20:1040630-1040652 CTCAAACTATCCAACAATGGAGG + Intergenic
1170727923 20:18946619-18946641 CTCAAACCAGCAAACAATTTTGG + Intergenic
1171261577 20:23738861-23738883 CTCAGACAAACAAACACTGGTGG + Intergenic
1171270714 20:23814751-23814773 CTCAGACAAACAAACACTGGTGG + Intergenic
1172940593 20:38651214-38651236 CACAAGCAAGCTACCACTGGGGG + Intergenic
1177489985 21:21810919-21810941 CACAAGCAAACAAGCAATGGAGG - Intergenic
1180588367 22:16914161-16914183 CTCAGACAAGCAGCCCATGCGGG + Intergenic
1181754990 22:25017380-25017402 CTCAAACAAACAAAAAAAGGGGG + Intronic
949858375 3:8483142-8483164 ATGAAACAAGTAACTAATGGTGG + Intergenic
951040440 3:17983344-17983366 CTCAAACAAACAGCCACTTGTGG + Intronic
953823513 3:46230521-46230543 ATCACACAAGCAAAAAATGGTGG - Intronic
955707535 3:61744012-61744034 CTCAGACAGACAACCAAAGGCGG - Intronic
956586464 3:70870496-70870518 TTAAAACAACCAACCAATGTGGG - Intergenic
961831513 3:129625376-129625398 CCCAAACAAGCAGCCTCTGGAGG - Intergenic
964013976 3:151924445-151924467 CTCAAAAAACCAACCAACTGTGG - Intergenic
964481923 3:157147682-157147704 CTCAAACTACCATCTAATGGAGG + Exonic
965022692 3:163253941-163253963 CTTAAACAAGAATCCAAAGGTGG - Intergenic
967142828 3:186576670-186576692 CTCAACCAAGCACTAAATGGTGG - Intronic
967503865 3:190231200-190231222 TTCTAACAAGCTCCCAATGGTGG - Intergenic
967775940 3:193386104-193386126 CGCCAAAAAGCAACCACTGGAGG + Intergenic
968315062 3:197717125-197717147 CACAAACAAACAAACAAAGGGGG + Intronic
968468558 4:765625-765647 CTGAAGCAGGAAACCAATGGTGG + Intronic
969024846 4:4164788-4164810 CTCAAACGAGCTGCCAAGGGAGG + Intergenic
971624023 4:28895517-28895539 TTCAAACAAGCAACCGCTGGGGG + Intergenic
974373535 4:61047153-61047175 CTCATGCAAGCCACCAATGTGGG - Intergenic
977114544 4:93006746-93006768 CCTAAACAAGCAACCACCGGTGG - Intronic
977168098 4:93726248-93726270 CTGACAAAAACAACCAATGGGGG - Intronic
978859779 4:113434587-113434609 CTGGAACAAGCAACAAATTGTGG + Intergenic
980117042 4:128689327-128689349 CTCAAACAAGCCTCCAAAGTAGG - Intergenic
985377041 4:189352024-189352046 ATCAAACAAGTAACAAATGAAGG + Intergenic
987113428 5:14708188-14708210 CTCAAACAGGCCACCAAAGGAGG + Exonic
988853568 5:35203170-35203192 CTCAAACAAGAAAGCATTTGAGG - Intronic
989597221 5:43167810-43167832 CACAAACAAGCAACCCAGGCAGG - Intronic
991118758 5:62985940-62985962 CTCAGACAAGCAAACACTGAGGG + Intergenic
994795872 5:104299093-104299115 CAACAACAAGCAACCTATGGAGG - Intergenic
995419197 5:111944306-111944328 CTCAAAAAAGAAAAAAATGGAGG - Intronic
995904268 5:117104834-117104856 CACAAACAAGCTTCCAGTGGAGG - Intergenic
998210504 5:140193721-140193743 CTCACAGAAGCAAACCATGGAGG + Intronic
998866690 5:146511909-146511931 CTGAAACGAGCAACCTATGAAGG - Exonic
1001691213 5:173633912-173633934 CTCATCCAAGCAGCCCATGGAGG + Intergenic
1008870772 6:56269864-56269886 CTCAGACAAGCAAACACTGATGG + Intronic
1010701943 6:79060464-79060486 CTCAAACAACTCACCAATGCTGG + Exonic
1011420442 6:87166179-87166201 CTGAAAAAAGTAAACAATGGAGG - Intronic
1012590694 6:100976552-100976574 CTGAAAAAAACAAGCAATGGGGG + Intergenic
1013706973 6:112847842-112847864 CTCAAAAAACAAAACAATGGCGG - Intergenic
1014074142 6:117217197-117217219 CTCACACAAGAAAAAAATGGTGG + Intergenic
1014202296 6:118620382-118620404 CTCAGACAAGCAAACATTGGAGG + Intronic
1017357180 6:153523370-153523392 ATCTCACAAGCAACCAATTGTGG - Intergenic
1019086674 6:169484897-169484919 CTGACAAAAGCAAGCAATGGGGG + Intronic
1023460941 7:40396125-40396147 CTCAAAAATGCAAAAAATGGGGG - Intronic
1023887037 7:44366122-44366144 CTCAACCAAGCAGCCATTGCTGG - Intergenic
1027659453 7:80971467-80971489 CTGAAACCAGAACCCAATGGGGG - Intergenic
1029624985 7:101715098-101715120 CTCAAATCAGCAACAGATGGAGG + Intergenic
1029818163 7:103118185-103118207 CTCAAACAACCAACCAAAAAAGG + Intronic
1030360066 7:108586468-108586490 CGAGAAAAAGCAACCAATGGAGG - Intergenic
1030429981 7:109432938-109432960 CTCAGACAAGCAAATGATGGGGG + Intergenic
1031825998 7:126566517-126566539 ATCAAAAAAACAACCAATGTTGG + Intronic
1032608670 7:133387613-133387635 TTCATACAAGTAACAAATGGGGG - Intronic
1039296552 8:36162392-36162414 GTCAAAAAAGCAATCAATAGGGG - Intergenic
1040527747 8:48239498-48239520 CTCAAACAAACAAACCTTGGTGG + Intergenic
1043076484 8:75707740-75707762 TTCATACCAGAAACCAATGGTGG + Intergenic
1046496224 8:115017731-115017753 CTCAAACAAGCAAATGATGATGG - Intergenic
1047530008 8:125665834-125665856 CTCAAATAAGCAGTCAATGTTGG - Intergenic
1048554293 8:135458702-135458724 CTCAAGCCAGCCACCAATGAGGG - Intronic
1050053487 9:1627374-1627396 TCTAAACAAGCAACCCATGGGGG + Intergenic
1050993515 9:12183369-12183391 CTCAAACAATTCACCAATGTAGG - Intergenic
1055207423 9:73749872-73749894 CTCAGACAAGCAAACATTGAGGG - Intergenic
1055603469 9:77944329-77944351 CTCCATCAAACAACCAATAGAGG + Intronic
1056457515 9:86774998-86775020 CCCAAAGATGCAACCAGTGGGGG + Intergenic
1059423721 9:114207963-114207985 CTCAAACAAGCAACCAATGGAGG - Intronic
1186600623 X:11033438-11033460 GTCAAAAAAACAACCAATGCTGG + Intergenic
1187720949 X:22150311-22150333 TTCTAACAAGCTCCCAATGGAGG + Intronic
1188246722 X:27843864-27843886 ATAAAACAAGCAACCAGTAGTGG - Intergenic
1190032637 X:46989136-46989158 TTGAAAAAAGCAGCCAATGGCGG - Intronic
1194245171 X:91501788-91501810 CTCAGACAAGCAAACACTGAGGG + Intergenic
1195501314 X:105602876-105602898 CTCAGACAAGCAAAAAATGAGGG + Intronic
1198444765 X:136701522-136701544 CTCAAACAAACAAAAAATGTGGG + Intronic
1198479143 X:137024727-137024749 CTCAGACAACCAACCAAAGGGGG + Intergenic
1199050451 X:143231228-143231250 CGAAAACAAGAAACAAATGGAGG + Intergenic
1200564142 Y:4743098-4743120 CTCAGACAAGCAAACACTGAGGG + Intergenic
1201410056 Y:13690686-13690708 CTCCAACAAGGAACCACTGGAGG + Intergenic
1201790092 Y:17830096-17830118 CTGAAACAAGCAAGCAATGGGGG + Intergenic
1201811462 Y:18075893-18075915 CTGAAACAAGCAAGCAATGGGGG - Intergenic
1202036828 Y:20644777-20644799 CTCAAACAGGCTACCAAGGGAGG - Intergenic
1202351736 Y:23999843-23999865 CCGAAACAAGCAAGCAATGGGGG + Intergenic
1202519043 Y:25670276-25670298 CCGAAACAAGCAAGCAATGGGGG - Intergenic