ID: 1059423948

View in Genome Browser
Species Human (GRCh38)
Location 9:114209356-114209378
Sequence GCAGAAGGAAGCTCGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059423948_1059423959 4 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423959 9:114209383-114209405 CCTGGAGCCCTGGCGTGGGGCGG No data
1059423948_1059423960 5 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423960 9:114209384-114209406 CTGGAGCCCTGGCGTGGGGCGGG No data
1059423948_1059423957 1 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423957 9:114209380-114209402 GGTCCTGGAGCCCTGGCGTGGGG No data
1059423948_1059423956 0 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423956 9:114209379-114209401 AGGTCCTGGAGCCCTGGCGTGGG No data
1059423948_1059423954 -6 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423954 9:114209373-114209395 TTCTGCAGGTCCTGGAGCCCTGG No data
1059423948_1059423955 -1 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423955 9:114209378-114209400 CAGGTCCTGGAGCCCTGGCGTGG No data
1059423948_1059423963 16 Left 1059423948 9:114209356-114209378 CCCAGCCGCGAGCTTCCTTCTGC No data
Right 1059423963 9:114209395-114209417 GCGTGGGGCGGGCCTCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059423948 Original CRISPR GCAGAAGGAAGCTCGCGGCT GGG (reversed) Intronic