ID: 1059424511

View in Genome Browser
Species Human (GRCh38)
Location 9:114212235-114212257
Sequence CCAGGTCCTTGCCCTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059424511_1059424521 7 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424521 9:114212265-114212287 GAGGGCTGGGCTGGCACATGGGG No data
1059424511_1059424516 -6 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424516 9:114212252-114212274 ACCTGGAGTCTGAGAGGGCTGGG No data
1059424511_1059424519 5 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424519 9:114212263-114212285 GAGAGGGCTGGGCTGGCACATGG No data
1059424511_1059424520 6 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424520 9:114212264-114212286 AGAGGGCTGGGCTGGCACATGGG No data
1059424511_1059424518 -2 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424518 9:114212256-114212278 GGAGTCTGAGAGGGCTGGGCTGG No data
1059424511_1059424515 -7 Left 1059424511 9:114212235-114212257 CCAGCTTCAGGGCAAGGACCTGG 0: 1
1: 0
2: 3
3: 23
4: 286
Right 1059424515 9:114212251-114212273 GACCTGGAGTCTGAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059424511 Original CRISPR CCAGGTCCTTGCCCTGAAGC TGG (reversed) Intronic
900297099 1:1957356-1957378 CCTGGTCCTGCCCCTGGAGCAGG - Intronic
901090055 1:6634990-6635012 CCAGGGCCTAGCCCTGACACAGG - Exonic
901512595 1:9724864-9724886 CCACCTCTTTGCCCTGATGCGGG + Exonic
901800733 1:11706570-11706592 GCAGGTCCTTGTCCTGCAGCAGG - Exonic
902472277 1:16657229-16657251 CCAGGGCCCTTCCCTGCAGCTGG - Intergenic
902486526 1:16750217-16750239 CCAGGGCCCTTCCCTGCAGCTGG + Intronic
902504358 1:16929827-16929849 CCAGGGCCCTTCCCTGCAGCTGG + Exonic
902540363 1:17149957-17149979 CCAGGTCCTGACCCTGAGGCAGG - Intergenic
902790503 1:18764675-18764697 CCAGCTCCCTGCCCGAAAGCAGG + Intergenic
903012826 1:20343185-20343207 CCAGGGCCTTGCCCAGCACCGGG - Exonic
903972703 1:27129470-27129492 CCAGGACCAAGCCCTGCAGCTGG - Intronic
904675614 1:32197552-32197574 CCAGGTCCTGGGCCAGATGCAGG + Exonic
904971999 1:34426535-34426557 CCAGGTCCAAGCCCTGTGGCTGG + Intergenic
906190688 1:43897892-43897914 CCAGGGCCTTCCCTGGAAGCTGG - Intronic
906252331 1:44320097-44320119 CCAGGTCCCTGTCCTGAAATGGG + Intronic
906568553 1:46817576-46817598 CCAGGTGCTTGCTATGAACCAGG - Intronic
906733558 1:48103418-48103440 TGAGGGCATTGCCCTGAAGCTGG + Intergenic
906750159 1:48251694-48251716 TCAGCCCCTTGCCCTGAAGTGGG + Intergenic
907439746 1:54471827-54471849 CCAGGGCCTTGCCCTGGGGGTGG + Intergenic
907581708 1:55578125-55578147 CCAATTCCCTGCCCTGAACCAGG + Intergenic
909761148 1:79288965-79288987 CCCTGACCTTACCCTGAAGCAGG + Intergenic
910508314 1:87975819-87975841 CAATGACCTTCCCCTGAAGCAGG - Intergenic
911646064 1:100338204-100338226 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
912388898 1:109288013-109288035 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
912556680 1:110521196-110521218 CCAGGTCCTTGTCCTCAAGACGG - Intergenic
913440183 1:118888779-118888801 ACTGGTCCTAGCCCTGCAGCAGG + Intronic
915074294 1:153296152-153296174 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
916717440 1:167457125-167457147 CCAGCTCCTAGCGCTAAAGCAGG - Intronic
917640330 1:176977506-176977528 CCGGGTCCTTGTCCTGGATCAGG + Intronic
918192763 1:182191963-182191985 CCAGTTCCTTGCCCCAAATCAGG - Intergenic
919358703 1:196562096-196562118 CCAGGTCTTTTCCCTGATCCAGG - Intronic
919751812 1:201042495-201042517 CCTGGGCCCTGCCCTGAAGGGGG - Intronic
920172131 1:204078697-204078719 TCAGCTCCCTGCCCCGAAGCAGG + Intronic
920294803 1:204949388-204949410 CCATGGCTTTGCCCTGATGCTGG + Intronic
923328766 1:232903222-232903244 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1062803617 10:398158-398180 CCAGGTCCTTTTCCTGATCCAGG + Intronic
1065820116 10:29517539-29517561 CCAGGTTCTTACCCTGTAGCTGG - Intronic
1065952809 10:30667360-30667382 CCAGGTTCTTACCTTGTAGCTGG + Intergenic
1066292861 10:34029730-34029752 CCAGGCCCTGGCGCAGAAGCTGG + Intergenic
1067143591 10:43677004-43677026 CCCGGTTCTTGCCATGGAGCTGG + Intergenic
1067729354 10:48798874-48798896 CCTGGTCCTGGATCTGAAGCTGG + Intronic
1073052973 10:100681166-100681188 CCCGGTCCTTGGGCAGAAGCTGG + Intergenic
1073330273 10:102665920-102665942 CCAGCTCAGTGCCCTGCAGCAGG - Intergenic
1075744782 10:124719326-124719348 CCAGGTCTTTGCCCTAAGTCAGG - Intronic
1076054227 10:127358245-127358267 CCAGATCCTTGCTCTGAGGCTGG - Intronic
1076529742 10:131136372-131136394 CCAGGCCCTCGTCCTGAAGCTGG - Intronic
1076715310 10:132361042-132361064 CCTGGTTCTGGCACTGAAGCTGG + Intronic
1077117669 11:892608-892630 CCAGGTTCCTCCCCTGGAGCTGG - Intronic
1078083704 11:8221314-8221336 CCCACTCCTTGGCCTGAAGCTGG - Intergenic
1078086646 11:8237472-8237494 CCAGGGCCTTGCCATGCAGCAGG + Intronic
1078519387 11:12051125-12051147 CCATGACCTTCACCTGAAGCTGG - Intergenic
1079378760 11:19918092-19918114 CCAGGTTCTCTCCCTGAAGAGGG - Intronic
1081758148 11:45559230-45559252 CCTGGTCCTGGCCCTGAGCCAGG - Intergenic
1081855027 11:46297446-46297468 TCCGGTAATTGCCCTGAAGCAGG - Intronic
1082203794 11:49405987-49406009 CCAGGCCCCTGCCCTCCAGCAGG - Intergenic
1083814885 11:65127056-65127078 CTTGGTCTCTGCCCTGAAGCAGG + Exonic
1083890413 11:65593012-65593034 GCAGGGGCTTGTCCTGAAGCTGG + Exonic
1084021919 11:66422844-66422866 CCAGGTCCTGGCCCTGGCCCTGG + Exonic
1085738972 11:79063301-79063323 CCTGGTCCCTGCCCTGATCCAGG + Intronic
1086651296 11:89294447-89294469 CCAGGCCCCTGCCCTCCAGCAGG + Intronic
1088330101 11:108642502-108642524 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1088756234 11:112887481-112887503 CCAGGTCCTTGCTGTGATGGAGG + Intergenic
1089085710 11:115815323-115815345 CTAGGTCCTTGCCCTGCCCCAGG + Intergenic
1090253369 11:125266024-125266046 CCAGGTCTCTGCCCCGAGGCAGG + Intronic
1091386143 12:96419-96441 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1092979282 12:13777513-13777535 CCAGGTCCTTATTCTGAAGATGG - Intronic
1093662426 12:21773365-21773387 CCATGTCCTTCCTCTGCAGCTGG - Exonic
1095493333 12:42759147-42759169 CCATGCCCCTGCCCTGCAGCTGG - Intergenic
1097707507 12:62883101-62883123 CCAGCACCTAGCCCTGAATCTGG + Intronic
1097790042 12:63805807-63805829 CAAGGTCCATGTCCTGAAGATGG - Intronic
1098033991 12:66283552-66283574 CATGGTCCTTGCCCTCAAGAAGG - Intergenic
1098876620 12:75872418-75872440 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1098930726 12:76409241-76409263 CTCTGACCTTGCCCTGAAGCAGG + Intronic
1099618838 12:84975471-84975493 TCAGTTCCATGTCCTGAAGCGGG - Intergenic
1099765791 12:86981693-86981715 CCAGGTCCTTCCCTTGACACAGG - Intergenic
1102463716 12:113115710-113115732 CCAGGACCTTGCCACCAAGCTGG - Exonic
1102761937 12:115395340-115395362 CTTGATCCTTGCCCTGAAGGAGG - Intergenic
1103973404 12:124686557-124686579 TCAGGACCCTGCCCTGGAGCTGG - Intergenic
1104661914 12:130617252-130617274 CCAGGCCCACGCCCTGCAGCTGG + Intronic
1106678668 13:31987607-31987629 CCACCTCCTTTACCTGAAGCTGG - Intergenic
1108340848 13:49496657-49496679 TCAGGACCTTGCCCTGAGCCTGG - Intronic
1108536761 13:51389318-51389340 CCAGATCCTTCCCCTGTAGAAGG - Exonic
1108550195 13:51536264-51536286 CCAGGCCCTTGCCTTAAGGCAGG + Intergenic
1109283351 13:60382461-60382483 CAAGCTCCTTGTCCTGTAGCAGG + Intergenic
1111650504 13:91084931-91084953 CAAGGTCATTGCCCGCAAGCAGG - Intergenic
1113408551 13:110063627-110063649 CCAGTTCCATGCCCAGAAACAGG + Intergenic
1113416165 13:110130270-110130292 CCAAGTCCTAGCCATGAAACAGG + Intergenic
1113710169 13:112457823-112457845 CCAGGTCCTGGGCCTGACTCAGG + Intergenic
1113990895 14:16026055-16026077 CCAGTCCCTCTCCCTGAAGCCGG + Intergenic
1114073236 14:19131910-19131932 CCAGCTCCTGCCCCTGACGCTGG - Intergenic
1114089030 14:19268073-19268095 CCAGCTCCTGCCCCTGACGCTGG + Intergenic
1115143946 14:30205205-30205227 GCAGGCCCTTGACCTGAACCTGG - Intergenic
1116955181 14:50915990-50916012 TCAGCTGCTTGCCCTGAAGGTGG + Intronic
1117274054 14:54174421-54174443 CCAGTTCCTTGCCCTCAGGTAGG + Intergenic
1118856854 14:69629708-69629730 CCAGCTTCTTGCCGTGAGGCTGG + Intronic
1118978987 14:70701085-70701107 CCAGCTCCCAGCCCTGAAGCAGG + Intergenic
1122016834 14:98803509-98803531 CCAGGCCCTTGGCCTGCAGCAGG - Intergenic
1122266793 14:100550425-100550447 CCAGGTCCTCGCCCTCCATCTGG - Intronic
1122799098 14:104221013-104221035 CCAGGACCCTGCTCTGTAGCGGG + Intergenic
1122888123 14:104719548-104719570 CCAGGTGTGTGCCCTGAGGCTGG + Exonic
1123063647 14:105605682-105605704 CCAGGTCACTGTCCTGCAGCCGG + Intergenic
1123442535 15:20302253-20302275 CCAGGCCCTGGCCCTGCTGCTGG + Intergenic
1124603488 15:31153148-31153170 CCAGGTCTTTTCCCTGATACAGG + Intronic
1126663895 15:51058063-51058085 CCAGGTCCTTGCACTCATGCAGG + Exonic
1127957095 15:63863048-63863070 CCAGCTCCTTGCCAAGATGCTGG - Intergenic
1129416076 15:75381488-75381510 CCAGGTCCTGACCCTTAAACAGG + Intronic
1130520665 15:84658426-84658448 CCCGGTCCTTAGCCTGAAGGTGG - Exonic
1131723069 15:95192359-95192381 CCATGTCCTAGCACTGAATCTGG - Intergenic
1132338740 15:101064969-101064991 CCAGGTCCTGCCTCTGAAGGAGG + Intronic
1132536451 16:483666-483688 CCAGGTCTTTTCCCTGGTGCAGG + Intronic
1134122681 16:11596262-11596284 CAGGGCCCCTGCCCTGAAGCAGG - Intronic
1135894609 16:26387509-26387531 CCTGGGCTTTCCCCTGAAGCAGG - Intergenic
1136035841 16:27539529-27539551 CCAAGCCCTGGCCCTGCAGCTGG + Intronic
1136236901 16:28919899-28919921 CCAGATCACCGCCCTGAAGCAGG - Exonic
1136630312 16:31486044-31486066 CCAGGTCCCAGCACTGTAGCTGG - Intronic
1136686233 16:31996365-31996387 ACAGGGCCTTGGCCTGAGGCAGG + Intergenic
1136786846 16:32939894-32939916 ACAGGGCCTTGGCCTGAGGCAGG + Intergenic
1136882926 16:33913896-33913918 ACAGGGCCTTGGCCTGAGGCAGG - Intergenic
1138428658 16:56953277-56953299 CCAGGTCATTGACCTACAGCAGG - Intergenic
1138851222 16:60632198-60632220 CAAGTACATTGCCCTGAAGCTGG + Intergenic
1139595228 16:67953985-67954007 CCAGGTCCTCTACCTGCAGCAGG - Intronic
1140673085 16:77298451-77298473 CCAGCTCCTGGGGCTGAAGCAGG + Intronic
1141078140 16:81027371-81027393 CCAGCTACTTGCACTGAAGCGGG + Intronic
1141864008 16:86737345-86737367 ACAGGGCTTTGCCGTGAAGCTGG - Intergenic
1142416384 16:89945427-89945449 CCAGGTACTTGGCCTGAGGCGGG + Intergenic
1203089082 16_KI270728v1_random:1201564-1201586 ACAGGGCCTTGGCCTGAGGCAGG + Intergenic
1143250969 17:5522727-5522749 CCAGCCCCTGGCCCTGGAGCTGG + Intronic
1144416361 17:15050949-15050971 CCAGGGTCTTGCCCTGTAACTGG - Intergenic
1144422017 17:15107542-15107564 CCAAGTCCATGCACTGAATCTGG + Intergenic
1144577334 17:16437316-16437338 CCAGGTACCTGCCCAAAAGCAGG - Intergenic
1146000646 17:29128361-29128383 CCAGGGCCTGTCCCGGAAGCGGG - Intronic
1147147195 17:38492033-38492055 ACAGGGCCTTGGCCTGAGGCAGG + Intronic
1149640490 17:58199565-58199587 CCCGGGCCTTGCCCAGAACCAGG - Exonic
1151821465 17:76499319-76499341 CCACGTCCATGCCCAGGAGCTGG - Intronic
1151834553 17:76574298-76574320 CCTGCTCTTTGCCCTGAAGTAGG - Intronic
1151868477 17:76820609-76820631 GCAGGTCCTTGCCATGCAGGAGG + Intergenic
1152125778 17:78445662-78445684 CCAGGTCCTGTCCATGAAGAAGG - Exonic
1154175863 18:12087041-12087063 CCAGGCCCTGGCCCTGACCCTGG + Intergenic
1154415303 18:14172793-14172815 TCTGGTCCTTGCCCTGACTCTGG - Intergenic
1157018210 18:43744873-43744895 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1157468199 18:47966712-47966734 CCAGGCCCTTCCTCTGAAACTGG - Intergenic
1158521794 18:58177182-58177204 CCACGCCCGTGCCCTGAATCTGG + Intronic
1159109535 18:64041176-64041198 CCTCTTCCTTGCTCTGAAGCCGG - Intergenic
1161358640 19:3833915-3833937 CCAGGCCCTGGCCCGGAGGCAGG + Intronic
1161596283 19:5152568-5152590 CCTCGTCCCTGCCCGGAAGCAGG - Exonic
1162526979 19:11211864-11211886 TCAGGTCCTGGACCTGGAGCCGG + Exonic
1163311520 19:16517732-16517754 CCATGTCCTTACCCTCGAGCAGG - Intronic
1163746120 19:19048717-19048739 CCAGGTCTTTTCCCTGATTCAGG - Intronic
1166068055 19:40371663-40371685 CCAGCTCCTTGACCTGTAGGAGG - Exonic
1166314037 19:41978681-41978703 GCTGCTCCTTGCCCTGTAGCAGG + Exonic
1166719682 19:44989912-44989934 CCAGGCCCCTGCCCTGACACCGG - Intronic
1202704674 1_KI270713v1_random:14023-14045 CCAGGGCCCTTCCCTGCAGCTGG - Intergenic
925688495 2:6496110-6496132 CCACCTCTTTGCCCTGATGCAGG - Intergenic
926679616 2:15653698-15653720 CCAGGTTCATGTCCTGACGCTGG - Intergenic
926813652 2:16779202-16779224 CCAGTTCCTTGCCTGAAAGCGGG - Intergenic
927711783 2:25330690-25330712 CTGGGACCTTGCCCTGTAGCTGG - Intronic
929749101 2:44691375-44691397 CCATGTCCTGACACTGAAGCAGG - Intronic
930879483 2:56255179-56255201 CCAGTTCCTTGCCGTGAAGTGGG - Intronic
932334287 2:70921126-70921148 CCAGGTCCAGGCCCTTAGGCAGG - Exonic
934784596 2:96995933-96995955 CCAGTGCCTGGCCCTGAACCTGG - Intronic
935951454 2:108333235-108333257 CCAAATCCTTGCCCTGCATCAGG + Intergenic
935951511 2:108334037-108334059 CCAACTCCTTGCCCTGCATCAGG + Intergenic
937342966 2:121103712-121103734 CAAGGTCCTTGCCATAAATCCGG - Intergenic
937857934 2:126686192-126686214 TCAGGTGCTAGCCCTGAGGCTGG - Intronic
937914881 2:127094003-127094025 CCTGCTCCCTGCCCTGGAGCAGG + Intronic
939716414 2:145589765-145589787 ACAAGTCCTTGCCCTCAAGAAGG + Intergenic
940658674 2:156519957-156519979 CCAGGTTCTTGCCCAGCATCTGG + Intronic
944991705 2:205245100-205245122 CCAGCACCATGCCCTCAAGCTGG + Intronic
945100344 2:206257400-206257422 CCAGGTTATTCCGCTGAAGCCGG + Intergenic
948318731 2:237051964-237051986 CCAGCTCATTGCGCTGCAGCAGG + Intergenic
948557521 2:238823766-238823788 CCAGGTCCTTGCCATGGAAAGGG - Intergenic
948886720 2:240888483-240888505 CCAGGCCGCTGCCCTGCAGCAGG + Exonic
1169091422 20:2863388-2863410 CCACATCCTTGCCTTGTAGCAGG - Exonic
1169150611 20:3286585-3286607 CTAGGACCTTGCCCACAAGCAGG + Intronic
1170643508 20:18176621-18176643 CCAGGCGCAGGCCCTGAAGCAGG + Intronic
1171208974 20:23302473-23302495 CCAGCTGCTTGTCCTGAACCAGG + Intergenic
1172038722 20:32028934-32028956 CCAGCTCCTGGCCCTCAGGCAGG - Intronic
1173054714 20:39599826-39599848 CTTGGTCCTTGTCCTGAAGAAGG + Intergenic
1173623074 20:44451263-44451285 CCCCATCCTTGCCCTCAAGCTGG + Intergenic
1174057670 20:47809822-47809844 CCAGCTCCCTGCCCTGAGGCAGG + Intergenic
1175541626 20:59751503-59751525 CCTGGAGCTTGCCCTGAAGCAGG + Intronic
1175945632 20:62557498-62557520 CCACGCCCTGGCCCTGAAGATGG - Intronic
1176049162 20:63107589-63107611 CCAGCACCTGGCACTGAAGCTGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176858015 21:13986471-13986493 TCTGGTCCTTGCCCTGACTCTGG + Intergenic
1177271387 21:18852788-18852810 CCAGGTCCTTCCCATGAAAAGGG + Intergenic
1177833083 21:26161467-26161489 CGAGGTCCTTGCCCCCAAGAGGG - Intronic
1178961670 21:37072172-37072194 CCTGGTCCCTGCCCTTAAGGAGG - Intronic
1179548971 21:42131336-42131358 TCAGGTCTTGGCCATGAAGCTGG + Intronic
1180316375 22:11281471-11281493 CCAGTCCCTCTCCCTGAAGCCGG - Intergenic
1180491677 22:15854263-15854285 CCAGCTCCTGCCCCTGACGCTGG - Intergenic
1180750273 22:18119642-18119664 CCTGGTCCTTGCCTTGAGGGAGG - Intronic
1180841181 22:18959593-18959615 CCTGGTCCTGGCCGTGGAGCAGG + Intergenic
1181060317 22:20279201-20279223 CCTGGTCCTGGCCGTGGAGCAGG - Intronic
1181569961 22:23763201-23763223 CCAGAGCCCGGCCCTGAAGCAGG + Exonic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1182679566 22:32068207-32068229 CCAGACCCTTGCCCTGGAGGAGG - Intronic
1184047249 22:41979150-41979172 CCAGGTCCTGGTCCTGTAGTGGG + Intronic
1184147337 22:42619313-42619335 CCTGGGCCTGGCCCTGAGGCGGG + Exonic
1184369944 22:44075926-44075948 CCAGGCCCCTGCCCTGAGGTTGG + Intronic
1184775382 22:46620494-46620516 TCAGGTCCTGGCCCAGAACCAGG - Exonic
1185380240 22:50504559-50504581 CTGGCTCCTTGCCCTGCAGCAGG + Exonic
1185385337 22:50529297-50529319 CCAGATCCATGCCCCGAAGTCGG + Exonic
950652425 3:14415616-14415638 AAAGCTCCTTGCCCTGAGGCTGG - Intronic
950668437 3:14511201-14511223 CCAGGTCCTCGCACTGCCGCAGG + Exonic
953227014 3:41030267-41030289 CCAGCTCCCTTCCCTAAAGCTGG - Intergenic
953320088 3:41963580-41963602 CCAGGTCTTTTCCCTGATGCTGG + Intergenic
954125193 3:48524016-48524038 CCAGGACCTAGCCCTGAGGTGGG - Intronic
955328668 3:58029035-58029057 TCAGGTCACTGCACTGAAGCCGG + Intronic
955374784 3:58385935-58385957 CCTGGTCCTTGCTCTGATGGAGG + Intronic
955388360 3:58498565-58498587 CCAGATCTTTGCCCTGTAGTAGG + Exonic
955803841 3:62713450-62713472 CCAGGTCATTGCCCTGAAAAGGG - Intronic
956173198 3:66449361-66449383 CCAGCTCTTTGGCCTGAAGTTGG - Intronic
959564891 3:107824180-107824202 TCCTGGCCTTGCCCTGAAGCAGG - Intergenic
959856264 3:111162314-111162336 CCAGGTCCTTCCCATGATGTGGG - Intronic
961454822 3:127018700-127018722 CCAGGGCCTGGCCCTGCAGCAGG + Intronic
963174558 3:142284081-142284103 CAAGGGCTTTACCCTGAAGCAGG + Intergenic
967224206 3:187275357-187275379 CCAGGACCTTGCCCTGACTCAGG + Intronic
967894626 3:194385969-194385991 CCAGGTCCTTGTCTGGATGCCGG + Intergenic
968958563 4:3731099-3731121 CCAGGCCCTGGCCCTGGAGTAGG + Intergenic
969487439 4:7480175-7480197 TCTGGGCTTTGCCCTGAAGCAGG + Intronic
970744688 4:19280920-19280942 CCAGGTCCTTCCCCTAACACTGG + Intergenic
970789168 4:19836225-19836247 CCAGCACCTCTCCCTGAAGCTGG + Intergenic
975183373 4:71372730-71372752 CCAGGTCCCTGCCCAGTAGATGG - Intronic
975292121 4:72689239-72689261 CCAGGTTCTTTCTCTGAAGGAGG + Intergenic
977830491 4:101585549-101585571 ACAGGTGCTTGCCATCAAGCTGG + Intronic
979393286 4:120153621-120153643 CCAGCTACTTGGCCTGAGGCAGG + Intergenic
979633871 4:122935098-122935120 CCATCTCTTTGCACTGAAGCAGG + Intronic
981490736 4:145336717-145336739 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
983628492 4:169826647-169826669 CAAGGTCCCTGACCCGAAGCTGG + Intergenic
984756648 4:183331172-183331194 CCAGGGCCTGGCCCTGAGGCTGG - Intergenic
986858865 5:11903909-11903931 TCAGGACCTTGCCCTGAAGCCGG - Exonic
988565855 5:32319747-32319769 CCAGGTTCTTGTCCTGCATCCGG + Intergenic
990821128 5:59841545-59841567 CCAGGTCCTAGCCCTGTGACTGG - Intronic
993078713 5:83269331-83269353 CCAGGTGCTTTCCCTCAAGGAGG + Intronic
995477935 5:112566512-112566534 CCAGGTCCTTTCCCTAATACTGG + Intergenic
998098952 5:139416037-139416059 CAAGGTCATTGCTCTGGAGCAGG - Intronic
998518736 5:142781013-142781035 CCAGGTTCCTGGCATGAAGCAGG + Intronic
1000224641 5:159248845-159248867 CAAGGTCATTGCCCAGAAGATGG - Intergenic
1001076982 5:168637191-168637213 CCAGGTCGTTTCCCTGATCCAGG - Intergenic
1001144453 5:169171650-169171672 CAAGGTCCCTGCCCTGAGGCTGG + Intronic
1002453130 5:179331007-179331029 CCAGCTCCTTTCACTGCAGCTGG - Intronic
1002599287 5:180345123-180345145 CAAGCTCCTTGCCCTGTGGCAGG - Intronic
1002636763 5:180612508-180612530 GCAGGCCCCTGCCCTGGAGCAGG + Exonic
1003020217 6:2503001-2503023 CCAGGTGCTTGGCATGCAGCAGG - Intergenic
1003167526 6:3694042-3694064 CCAGGGCTTTGCGCAGAAGCTGG - Intergenic
1003184329 6:3817609-3817631 CCAGCTACTTGGACTGAAGCAGG + Intergenic
1003354182 6:5350585-5350607 CCAGGACCATTTCCTGAAGCAGG - Intronic
1003787048 6:9498202-9498224 CCAGGTCTTTTCCCTGATTCAGG - Intergenic
1006332715 6:33403895-33403917 CCAGGGCCTTGACCTGCTGCTGG - Exonic
1006625257 6:35393080-35393102 CCTGGTCCTGGCCCTGAATTTGG - Intronic
1006635822 6:35460455-35460477 CCAGGGCCTTGCCCTGCTGTGGG + Intronic
1007396433 6:41580644-41580666 TCAGATCCTTGTCCTGAAGTAGG + Intronic
1011083192 6:83511701-83511723 CTCGGTCCTGGCCCTAAAGCAGG - Intergenic
1016834277 6:148461668-148461690 CCAAGTCCTGGCCCTGTGGCTGG + Intronic
1017836943 6:158187333-158187355 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1019314282 7:377329-377351 TCAGGTCCCTGCCCTGAGGGTGG - Intergenic
1021891073 7:25186992-25187014 CATGTTCCTTGCCCTGGAGCTGG + Intergenic
1023384030 7:39636954-39636976 CCAGGTCCATCCCCTGATGTGGG + Intronic
1024722105 7:52148855-52148877 CCAGGGCCTTTCCCTGATCCAGG + Intergenic
1026086367 7:67266443-67266465 CCAGGTCTTTTCCCTGATCCAGG + Intergenic
1026690781 7:72548386-72548408 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1029573941 7:101390748-101390770 CCACTTCCATGCCCTAAAGCTGG - Intronic
1030825734 7:114155545-114155567 TCAGGTCTTTTCCCTGATGCAGG + Intronic
1032097773 7:128947970-128947992 AAAGGTCCTGGCCCTGTAGCTGG - Exonic
1032469876 7:132170594-132170616 CCAGTGCCTTGCCCTGAGCCTGG - Intronic
1034223839 7:149467189-149467211 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1034250202 7:149684348-149684370 CCAGTCCATTCCCCTGAAGCTGG + Intergenic
1035006191 7:155662833-155662855 CGAGGTCCTTGTCCTCCAGCTGG + Intronic
1035818014 8:2561900-2561922 CCAGGTCACTGCCTGGAAGCAGG + Intergenic
1037603145 8:20415764-20415786 CCTGTTCCTTTCCTTGAAGCGGG + Intergenic
1037944693 8:22981553-22981575 CCAGGTCCTTGCCTCGAATTAGG + Intronic
1038660780 8:29494881-29494903 CCAGCTTCTTTGCCTGAAGCTGG - Intergenic
1039220053 8:35320456-35320478 CCAGGTCTTTTCCCTGATCCAGG - Intronic
1041255671 8:55978116-55978138 CCTGGTGCTGTCCCTGAAGCAGG + Intronic
1042419306 8:68566647-68566669 CCAGGTCCTTGCTCTGAACCAGG + Intronic
1043127471 8:76417935-76417957 CCGGGTCCCTCCCCTGAAACTGG - Intergenic
1044211941 8:89560851-89560873 CCAGGTCTTTTCCCTGATCCAGG - Intergenic
1045044064 8:98257643-98257665 CCAGGTCTTTTCCCTGATCCAGG + Intronic
1048801660 8:138199507-138199529 CCTGGTCCTTGCCCCAAGGCCGG - Intronic
1049204764 8:141358634-141358656 CCAGGGCATTGACCTGATGCTGG - Intronic
1049394847 8:142395206-142395228 CAAGGTCCTGGCCCTGGAGGAGG + Intronic
1051360693 9:16278973-16278995 CCTGCTCCTTGCCCAGAACCTGG - Intergenic
1053066922 9:35075508-35075530 CCCAGGCCTGGCCCTGAAGCAGG + Exonic
1054436154 9:65205156-65205178 CCAGGTCCTGGACCTGACTCTGG + Intergenic
1054494238 9:65816531-65816553 CCAGGTCCTGGACCTGACTCTGG - Intergenic
1055046078 9:71925548-71925570 ACAGGTCCCTTCTCTGAAGCTGG + Intronic
1056093754 9:83230359-83230381 CTAGGTCCTTGCTCTGGATCAGG + Intergenic
1056773310 9:89495356-89495378 CCAGGGCCTTCCCTGGAAGCTGG - Intronic
1057967024 9:99514053-99514075 CCAGGTCCTTGCTCTGAAGTTGG + Intergenic
1059424511 9:114212235-114212257 CCAGGTCCTTGCCCTGAAGCTGG - Intronic
1059460200 9:114424753-114424775 CCAGGTCCCTGCCCTCATGCGGG - Intronic
1061134956 9:128728519-128728541 CCAGGTCCAGGCCCTGCAGGGGG + Intergenic
1061139174 9:128753826-128753848 CCAGGTCCTGGTCCTGCACCAGG + Exonic
1061520047 9:131112383-131112405 CAAGTTCTTTGCCCTGGAGCCGG - Intronic
1061880371 9:133565949-133565971 CCAGCTCCCTGCCCAGGAGCAGG - Intronic
1062289943 9:135789954-135789976 CCAGGCCCTGGCACTGCAGCTGG + Intronic
1203364672 Un_KI270442v1:247420-247442 CCAGGCCCTCTCCGTGAAGCCGG - Intergenic
1186355344 X:8784127-8784149 GCAGGTCCTTGACCCGCAGCAGG + Intergenic
1186618626 X:11214992-11215014 TCAGGGCCTTGCCCTGATTCAGG - Intronic
1189523971 X:41800309-41800331 CCAGATCCTCCCTCTGAAGCAGG - Intronic
1190887775 X:54544305-54544327 CCAGGTTTTTGACCTGATGCTGG - Exonic
1192585897 X:72317934-72317956 CCAGGTCTCTGCCCTGAATATGG + Intergenic
1192904816 X:75540174-75540196 CCAGGTCCCTCCCCTGACACAGG + Intergenic
1195914713 X:109924757-109924779 CCCAGTCCCAGCCCTGAAGCAGG + Intergenic
1200573747 Y:4863745-4863767 CCATGTCCTCCCCCAGAAGCGGG - Intergenic
1201190161 Y:11438010-11438032 TCTGGTCCTTGCCCTGACTCTGG + Intergenic
1201773862 Y:17643934-17643956 CCACCTCCTTGACCTGAGGCAGG + Intergenic
1201827695 Y:18262055-18262077 CCACCTCCTTGACCTGAGGCAGG - Intergenic
1202245492 Y:22816045-22816067 CCAGGGCCTTGCACCGAAGAGGG + Intergenic
1202398481 Y:24449793-24449815 CCAGGGCCTTGCACCGAAGAGGG + Intergenic
1202472300 Y:25220293-25220315 CCAGGGCCTTGCACCGAAGAGGG - Intergenic
1202583467 Y:26403917-26403939 TCTGGTCCTTGCCCTGACTCTGG - Intergenic