ID: 1059426874

View in Genome Browser
Species Human (GRCh38)
Location 9:114226830-114226852
Sequence CAGGCACCTGCCTTTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059426867_1059426874 19 Left 1059426867 9:114226788-114226810 CCTGTGCTAGGCACTGGGATCAC 0: 1
1: 0
2: 8
3: 57
4: 327
Right 1059426874 9:114226830-114226852 CAGGCACCTGCCTTTGGTCTGGG No data
1059426866_1059426874 20 Left 1059426866 9:114226787-114226809 CCCTGTGCTAGGCACTGGGATCA 0: 1
1: 4
2: 13
3: 126
4: 668
Right 1059426874 9:114226830-114226852 CAGGCACCTGCCTTTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059426874 Original CRISPR CAGGCACCTGCCTTTGGTCT GGG Intronic
No off target data available for this crispr