ID: 1059427445

View in Genome Browser
Species Human (GRCh38)
Location 9:114230122-114230144
Sequence GACTCACTCATTGTGTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059427445_1059427456 25 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427456 9:114230170-114230192 CTGCTGTCCACTGGGTGGACAGG No data
1059427445_1059427452 16 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427452 9:114230161-114230183 TCCAGTGGTCTGCTGTCCACTGG No data
1059427445_1059427457 26 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427457 9:114230171-114230193 TGCTGTCCACTGGGTGGACAGGG No data
1059427445_1059427454 17 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427454 9:114230162-114230184 CCAGTGGTCTGCTGTCCACTGGG No data
1059427445_1059427448 -8 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427448 9:114230137-114230159 AGTGAGTCCCAGAGGAGAGTGGG No data
1059427445_1059427451 1 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427451 9:114230146-114230168 CAGAGGAGAGTGGGATCCAGTGG No data
1059427445_1059427455 20 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427455 9:114230165-114230187 GTGGTCTGCTGTCCACTGGGTGG No data
1059427445_1059427447 -9 Left 1059427445 9:114230122-114230144 CCAGTTCACACAATGAGTGAGTC 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1059427447 9:114230136-114230158 GAGTGAGTCCCAGAGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059427445 Original CRISPR GACTCACTCATTGTGTGAAC TGG (reversed) Intronic
905138536 1:35821010-35821032 CACTTAATCATTGTGTGATCAGG + Intronic
906549620 1:46652923-46652945 TACTGACTCATTGTTTAAACAGG - Intronic
906735965 1:48128484-48128506 GAATCACTCACTGTGAGAGCTGG + Intergenic
909714785 1:78694723-78694745 GTATCAATCATTGTGTGAATAGG + Intergenic
909945161 1:81655384-81655406 CACTCATTAGTTGTGTGAACAGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
923665049 1:235992132-235992154 TACTCACTCGCTGTGTGCACAGG + Intronic
1063844685 10:10113124-10113146 CACTGATTCATTGTGTGAATGGG + Intergenic
1065604138 10:27398796-27398818 GACTCACTCCTTGTGAGAAAGGG + Exonic
1068053989 10:51987551-51987573 AAGTCACTAATTGTGTGAATTGG + Intronic
1068914755 10:62417833-62417855 GACTGACTTTTTGTGTGAAAGGG + Intronic
1073520025 10:104120017-104120039 GACTTGCTTATTATGTGAACTGG - Intergenic
1073759868 10:106617895-106617917 CACTCACTCATAGTGTAAAGTGG - Intronic
1078371410 11:10749553-10749575 CACTCACTCATTTTGGAAACAGG + Intergenic
1078700815 11:13680686-13680708 TTCTCACTCATAGTGAGAACTGG - Intronic
1080534376 11:33207458-33207480 CACTTACTCACTGTGTGACCTGG - Intergenic
1083755758 11:64790732-64790754 GACCCAGTCACTGTGTGACCTGG + Intronic
1087520254 11:99224569-99224591 GAATCACTCATTGTGCCAGCTGG + Intronic
1087783855 11:102332028-102332050 GACTCAGTTCTTGTGTGGACAGG - Intronic
1089697451 11:120224958-120224980 TACTGACTCACTGTGTGAATGGG - Intronic
1096209692 12:49755355-49755377 GACTCACTCATAGTTTGACTTGG + Intronic
1100393753 12:94166666-94166688 TTCTCACTCACTGTGTGACCTGG - Intronic
1101493806 12:105235495-105235517 GACTGACTCATTATCTGTACCGG + Intronic
1101888674 12:108691866-108691888 GACTCACTGAATGTGTGCCCTGG - Intronic
1102092160 12:110200507-110200529 CACTCACTCATTGACTCAACCGG - Intronic
1105759271 13:23498580-23498602 GACACAGTTATTGTCTGAACAGG + Intergenic
1108028198 13:46200610-46200632 GCCTCACTCATTGTGAAAATAGG - Intronic
1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG + Intronic
1114562279 14:23602003-23602025 GCCTCAGTCATTATGTGATCTGG - Intergenic
1126684647 15:51237446-51237468 AACCCACCCATTGTGTCAACCGG - Intronic
1127659436 15:61086033-61086055 GTCTCACACATTGTGTAAAGAGG + Intronic
1132259574 15:100410572-100410594 GACTCACTCATTCAGAGCACTGG + Intronic
1134040138 16:11062094-11062116 GACTCACTGATTGTCTAAGCTGG + Intronic
1134815711 16:17204054-17204076 TCCTCACTCACTGTGTGACCTGG - Intronic
1137419698 16:48321455-48321477 GACTCACTGATTGAATAAACTGG - Intronic
1137565475 16:49530086-49530108 CACTCACTCGCTGTGTGGACTGG + Intronic
1138982295 16:62284231-62284253 TACTTACTCATTATGTGACCTGG + Intergenic
1141196345 16:81864502-81864524 CACTAACTCATTGTGTGAATTGG + Intronic
1141323919 16:83037782-83037804 CACTTACTCATTGTGTGACTTGG + Intronic
1141732061 16:85829507-85829529 CACTCTCTCCTTGAGTGAACAGG + Intergenic
1142277021 16:89124475-89124497 CACACACTCAGTGTGTGCACGGG - Intronic
1158219829 18:55139190-55139212 CACTCTCTAATTGTGTAAACTGG + Intergenic
1159072835 18:63645318-63645340 GACTAACACATTGAGTTAACAGG + Intronic
1159074279 18:63662955-63662977 GACTAACACATTGAGTTAACAGG + Intronic
1159629270 18:70730542-70730564 CACTTACTCAGTGTGTGACCTGG - Intergenic
1160548334 18:79677171-79677193 TCCACACTCACTGTGTGAACAGG - Intergenic
1167515182 19:49919163-49919185 AACTAACTCATTTTGTGAATAGG + Intronic
1168306762 19:55440217-55440239 GACTCTGCCATTGTGTGACCTGG - Intronic
926753021 2:16214048-16214070 GACTCACTCAGTTTGGGAAATGG + Intergenic
931951176 2:67363955-67363977 CACTCACTAGTTGTGTGAAATGG - Intergenic
932474511 2:71993619-71993641 GAGTCACTTATTGTGTGCATAGG + Intergenic
933415671 2:81984145-81984167 GTCTCACTCACTCTGTGGACAGG + Intergenic
936270533 2:111045406-111045428 AACTCACTCACTATGAGAACAGG - Intronic
937773640 2:125750395-125750417 CACTGACTTATTCTGTGAACTGG - Intergenic
941573790 2:167204496-167204518 AACTCACCCACTGTCTGAACTGG + Intronic
1168846138 20:945915-945937 GGCTCACTCATTGCGCCAACAGG - Intergenic
1168860419 20:1042458-1042480 TGCTCACTCACTGTGTGACCAGG + Intergenic
1169532539 20:6501300-6501322 CAGTGACTCATTGTGTGAATAGG + Intergenic
1170331555 20:15217427-15217449 CACTCACTCACTGTGTGAACTGG - Intronic
1172324388 20:34023274-34023296 GACTGACTCATTGTGGATACAGG + Intronic
1174898048 20:54471448-54471470 GAATCACTCATTGTTGGGACTGG + Intergenic
1179785407 21:43727234-43727256 GCGTCACTCACTCTGTGAACTGG - Intronic
1182422804 22:30256742-30256764 GCCTCACTCACTGTGTAAAATGG - Intergenic
1183043168 22:35198476-35198498 GAATCACTCAGTGTGTGACATGG - Intergenic
953537223 3:43785722-43785744 GACACACTCATAGTGTGAAGTGG - Intergenic
954303464 3:49713566-49713588 GACGCACGCATTGTGGGCACTGG + Exonic
961673018 3:128548559-128548581 GACTTTCTCCTTGTGTTAACAGG - Intergenic
975758036 4:77590690-77590712 CACACACTCATTCTGTGAGCAGG + Intronic
976711467 4:88075958-88075980 GACTCAGTCATGGTGGCAACTGG - Exonic
983387445 4:167083090-167083112 CACTCATTCATTGTGTGAGGGGG - Intronic
984429013 4:179624857-179624879 GCCCCTCCCATTGTGTGAACAGG - Intergenic
986821203 5:11468785-11468807 GACTCACTCATCTTGTCACCTGG + Intronic
988462402 5:31451869-31451891 CACTCATTCACTGTGTGACCTGG + Intronic
989231005 5:39086399-39086421 GACCCCCTAATTGTGTGTACAGG - Intergenic
996781201 5:127188647-127188669 AAATCACTCCTTCTGTGAACAGG - Intergenic
999248483 5:150167732-150167754 GATTAACTAACTGTGTGAACAGG + Intronic
1000102036 5:158025540-158025562 GAGTCACTCCCTGTGTGACCTGG + Intergenic
1000190049 5:158901757-158901779 TACTCACTCTCTGTGTAAACCGG - Intronic
1004106897 6:12674186-12674208 GACTGACTGAGTCTGTGAACAGG - Intergenic
1004214409 6:13688143-13688165 GACTCTCTCAGTCTGTGAAAAGG - Intronic
1005688894 6:28282607-28282629 GACTCACTGATTGTGTATAGAGG + Intronic
1015495139 6:133874068-133874090 TACGCACTCTTTGTGTAAACTGG + Intergenic
1017302644 6:152880330-152880352 GATTCACTGATTTTTTGAACGGG - Intergenic
1022212607 7:28226227-28226249 GAGTATCTCATTGTGTGAATAGG - Intergenic
1028530925 7:91837816-91837838 GACTCTCTCAATGTGGGCACTGG - Intronic
1032704195 7:134408007-134408029 CATTCACACATTGTGTGAAGTGG - Intergenic
1034022513 7:147660622-147660644 CACTCATTCATTCTCTGAACTGG + Intronic
1034101461 7:148454219-148454241 AACTCAGTCATTTTGTGACCTGG + Intergenic
1034959511 7:155356283-155356305 CACTCACTGATTGTGGGGACTGG + Intergenic
1036290937 8:7489631-7489653 GACTCACTCACTGTGTGATTTGG - Intergenic
1036330553 8:7821906-7821928 GACTCACTCACTGTGTGATTTGG + Intergenic
1037464961 8:19150932-19150954 GCCTAACTGAATGTGTGAACAGG - Intergenic
1045033655 8:98161306-98161328 GACTCCCTCATAGTCTTAACTGG + Intergenic
1047293488 8:123550928-123550950 TACTCATTCATTGTCTCAACAGG + Intergenic
1057915350 9:99051143-99051165 TACTGACTCACTGTGTGACCTGG - Intronic
1059427445 9:114230122-114230144 GACTCACTCATTGTGTGAACTGG - Intronic
1059903529 9:118955417-118955439 GACTGACACATTGTGAGTACAGG - Intergenic
1062619396 9:137412717-137412739 GACTCACACACTGTGTCCACTGG + Intronic
1189731197 X:44022842-44022864 TCCTCACTCATTCTGTGACCTGG - Intergenic
1200120235 X:153786739-153786761 GCCTCACTAAGTCTGTGAACAGG + Intronic
1201512394 Y:14779594-14779616 GACTCACGCAATCTGGGAACTGG - Intronic