ID: 1059427490

View in Genome Browser
Species Human (GRCh38)
Location 9:114230333-114230355
Sequence CCTTCCTTGCAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059427484_1059427490 -1 Left 1059427484 9:114230311-114230333 CCTGGCTGAGTGCTTCCCAGAGC 0: 1
1: 1
2: 2
3: 34
4: 274
Right 1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059427490 Original CRISPR CCTTCCTTGCAGAGGAAGGA AGG Intronic
No off target data available for this crispr