ID: 1059427775

View in Genome Browser
Species Human (GRCh38)
Location 9:114231819-114231841
Sequence CAGGGACTGATGGGCAGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059427767_1059427775 8 Left 1059427767 9:114231788-114231810 CCCATCACAGCTGGCCTTGGGCT 0: 1
1: 0
2: 0
3: 25
4: 199
Right 1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 217
1059427771_1059427775 -6 Left 1059427771 9:114231802-114231824 CCTTGGGCTTTGTCTTGCAGGGA 0: 1
1: 0
2: 2
3: 19
4: 211
Right 1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 217
1059427764_1059427775 16 Left 1059427764 9:114231780-114231802 CCTAGAGTCCCATCACAGCTGGC 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 217
1059427768_1059427775 7 Left 1059427768 9:114231789-114231811 CCATCACAGCTGGCCTTGGGCTT 0: 1
1: 0
2: 3
3: 49
4: 354
Right 1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 217
1059427762_1059427775 30 Left 1059427762 9:114231766-114231788 CCTGACTTCTGTGGCCTAGAGTC 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059427775 Original CRISPR CAGGGACTGATGGGCAGCGT GGG Exonic
901261627 1:7875793-7875815 CAGGGACTGGTGGGTAGTGATGG - Intergenic
902219912 1:14958200-14958222 CAGGCACTGATGGCGAGGGTAGG + Intronic
903976359 1:27152994-27153016 CAGGGACTTCTGGGCAATGTAGG + Intronic
904556379 1:31367534-31367556 CAGGAATTGAGGGGCAGGGTGGG + Intronic
905381009 1:37561638-37561660 CAGGGTCTGGTAGGCAGCGATGG - Exonic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906496555 1:46308378-46308400 AAGGAATTGGTGGGCAGCGTAGG + Intronic
907503983 1:54903770-54903792 CAGGCACTGATGGCCAGAATGGG + Intergenic
910179352 1:84464158-84464180 CAAGGACTGAGGGGCATCCTTGG - Intergenic
911057771 1:93722669-93722691 CAGGGACTGGTGGGCTGTGAGGG + Intronic
914446363 1:147753807-147753829 CAGGCACTGATGCGCAGGGGAGG - Intergenic
914944162 1:152048655-152048677 CAGAGCCTGGTGGGCAGGGTGGG + Intergenic
915316207 1:155030407-155030429 GAGGGGCTGCCGGGCAGCGTGGG - Intronic
915783601 1:158582137-158582159 CAGGGACTAGGGGGCAGCGAGGG + Intergenic
915831800 1:159138232-159138254 GAGGGAGTGATGGGAAGAGTTGG - Intronic
919860518 1:201736910-201736932 CAGGGAGTGGGGGGCAGCGGAGG - Intronic
1063083097 10:2787018-2787040 CAGGGTCTCATGGCCAGGGTTGG + Intergenic
1063690776 10:8285028-8285050 CAGGGCATGATGGGCAGGTTGGG + Intergenic
1067070326 10:43126261-43126283 CAGGGCCTGGAGGGCAGCCTTGG - Intronic
1067675308 10:48369811-48369833 CAGGTGCTGATGAGCAGCATAGG + Intronic
1069212642 10:65780276-65780298 CAGGGGCTGCTGGGCTGAGTGGG + Intergenic
1069835117 10:71303302-71303324 AAGGGAGTGATGGGCAGGTTGGG + Intergenic
1074385946 10:113016833-113016855 CAGGATCTGGTGGGCAGCGGAGG - Intronic
1074533634 10:114313327-114313349 CAGGGACGCGTGGGCAGAGTGGG + Intronic
1075800977 10:125153072-125153094 CCGGGCCAGATGGGCTGCGTGGG - Intronic
1077316460 11:1921421-1921443 GAGGGGCTGGTGGGCAGCCTGGG + Intronic
1079242266 11:18729317-18729339 CACGGACTGATGGGCAGACAAGG - Intronic
1080718380 11:34825625-34825647 CAGGGACTGGTGGGTAGGTTTGG - Intergenic
1083180694 11:60982855-60982877 CATGCCCTGCTGGGCAGCGTGGG - Intronic
1083194793 11:61079426-61079448 CAAGAACTGAGGGGCAGGGTGGG + Intergenic
1084473433 11:69376010-69376032 CAGGGACACATGGGCACCGAGGG + Intergenic
1085645192 11:78218250-78218272 CAGGGACTGAGGGGAACCCTGGG - Exonic
1088778270 11:113108071-113108093 TGGGGACTTATGGGCAACGTTGG - Intronic
1088877706 11:113949579-113949601 CAGGCCATGATGGGCAGCGGGGG + Intergenic
1089616027 11:119695308-119695330 CGGGGACTGGTGGGGAGGGTGGG - Intronic
1090206126 11:124885367-124885389 CTGGGACTGATGGGCTGAGTTGG - Intronic
1090446672 11:126770351-126770373 CAGTGACTGACGGGCAGGGATGG - Intronic
1090916186 11:131165129-131165151 CAGGGACTGAGGGACAGAGGGGG - Intergenic
1090985504 11:131762455-131762477 CATGGACAGATGGGCAGTGTGGG + Intronic
1094690078 12:32760237-32760259 CAGGTAAGGATGGGCAGAGTGGG - Intergenic
1096796175 12:54079374-54079396 AAGGGACTTCTGGGCTGCGTTGG - Intergenic
1098008683 12:66026836-66026858 CAGAGGCTGAGGGGCAGGGTGGG + Intergenic
1100297445 12:93275862-93275884 CAGGCACTGATGGGGAGAGGTGG + Intergenic
1102587281 12:113932364-113932386 CAAGGCCTGCTGGGCAGTGTGGG - Intronic
1102592806 12:113969708-113969730 CTGGGGCTGAAGGGCAGAGTAGG + Intergenic
1102609814 12:114101848-114101870 CAGGGCCTGTTGGGGAGGGTGGG + Intergenic
1103447534 12:121004012-121004034 CAGGGTCTCATGGGCAGTCTGGG + Exonic
1103848939 12:123918537-123918559 CAGGGACTGCAGGGGAGCGAGGG - Intronic
1104837273 12:131799831-131799853 CAGGGACAGGTGGGCAGCACTGG + Intergenic
1105596429 13:21843576-21843598 AAGGAACTGCTGGGCGGCGTCGG + Intergenic
1107352610 13:39531645-39531667 CAGGGGCTGATGGGAAGCTGCGG - Intronic
1110928409 13:81184900-81184922 CAGGAACTGATGGGTGGGGTGGG - Intergenic
1111376558 13:87386559-87386581 CAGGGTTTGATAGGCAGCCTAGG - Intergenic
1111971371 13:94920343-94920365 CAAGGACTGATGGGAAGATTAGG + Intergenic
1112541471 13:100317896-100317918 CAGGGACTGATGGCAAGAATGGG - Intronic
1112734933 13:102405918-102405940 CAGAGCCTGGTGGGCAGGGTAGG - Intergenic
1113384162 13:109832983-109833005 CAGGGACTGTTGGGGATTGTGGG + Intergenic
1113455969 13:110449348-110449370 CTGGGGCTGAGGGGCAGAGTGGG + Intronic
1117253488 14:53956341-53956363 CAGGGACTGCTGGACAGAGAAGG + Intronic
1119404279 14:74387036-74387058 GAAGGACTGGTTGGCAGCGTGGG + Intergenic
1120841959 14:89094077-89094099 CAGGGACTGAGGGCGAGCATGGG - Intergenic
1122084556 14:99290609-99290631 CAGGGACTGATGTGCTGTGATGG - Intergenic
1122175943 14:99919109-99919131 CAGTGCCTGATGGGCAGCCCTGG - Intronic
1122390273 14:101375460-101375482 CAGGGAGTGAGGGGTAGCGGAGG - Intergenic
1123117041 14:105899510-105899532 CAGGGACAGCAGGGCAGCCTGGG + Intergenic
1123439873 15:20282494-20282516 CAGGCGCTGATGGGCAGAGGTGG + Intergenic
1124198756 15:27658032-27658054 CAGGGAGAGAAGGGCAGCCTGGG - Intergenic
1124222745 15:27864139-27864161 CTGGTACTGATGGGCTGTGTGGG - Intronic
1126468960 15:48986455-48986477 AAGAGGCTGCTGGGCAGCGTTGG + Intergenic
1126859699 15:52871879-52871901 CTGGGACTGATGGTCAGGGGAGG - Intergenic
1127578018 15:60311626-60311648 CAGGGCCTGTTGGGCAGAGCGGG + Intergenic
1128773569 15:70301785-70301807 CAGGGACAGATGGCCAACCTGGG + Intergenic
1129299875 15:74619432-74619454 CAGGGACAGCTGGGCAGGGATGG - Intronic
1129539070 15:76336617-76336639 CAGGGGCTGATGGGCGGGGTGGG - Intergenic
1129690858 15:77712565-77712587 CTGGGACTGCTGGGCAGTGCTGG - Intronic
1129856487 15:78828886-78828908 CAGAGACTGAAGGGCAGGGCAGG - Intronic
1132467997 16:86472-86494 CAAGGACTGGAGGGAAGCGTAGG + Exonic
1133013951 16:2930404-2930426 CAGGGACTGAGGGGCTGCTGGGG - Exonic
1134107769 16:11496016-11496038 CAGGGACTGCTTGGCAGCTGTGG + Intronic
1137979128 16:53055047-53055069 CGGGGACTGGAGGGCAGCGCCGG + Exonic
1141166679 16:81665496-81665518 CAGGGTCTGATGAGCAGCTGTGG + Intronic
1141593868 16:85085948-85085970 AAGAGACTGGTGGGAAGCGTGGG + Intronic
1141829049 16:86499264-86499286 CAGGGGCAGGTGGGCAGCGGTGG + Intergenic
1141905772 16:87026195-87026217 CAGGGAATAATCGGCAGCGATGG + Intergenic
1141971531 16:87487405-87487427 CAGGGCCTGGTGGGCAGGGGCGG - Intronic
1142012306 16:87721884-87721906 CATGGACACATGGGCAGCGAGGG - Intronic
1142120493 16:88384193-88384215 CAGAAACTGATGGTCAGAGTGGG + Intergenic
1142620887 17:1165233-1165255 CAGGGACTGAGGGGCATTTTTGG - Intronic
1143129968 17:4671934-4671956 CAGGGACGGAGGAGGAGCGTGGG - Exonic
1143301624 17:5914853-5914875 CAGGGAGTGAGGGGCAGTGATGG + Intronic
1144726187 17:17503860-17503882 CTGGGACTGATGGGGAGTGGAGG + Intergenic
1147119916 17:38329870-38329892 CAGGGACTGGAGGCCAGCTTTGG + Exonic
1147336070 17:39727569-39727591 GAGAGACTGATGGGCAGGGGAGG + Intronic
1149627066 17:58087237-58087259 CTGGGACTGATGGCCAGGGGTGG + Intronic
1151183989 17:72350114-72350136 CAGGCTGTGATGGGCAGGGTAGG - Intergenic
1151408068 17:73902300-73902322 CAGGGACTGAGGGGGCTCGTCGG + Intergenic
1152716362 17:81902542-81902564 CGGGGACTGATGGGGGGCGGCGG + Intronic
1152987668 18:334897-334919 CAGGGACTTCAGGGCACCGTTGG - Exonic
1153006933 18:505223-505245 CAGAGCCTGATGGGCACCTTGGG + Intergenic
1158592390 18:58788758-58788780 CAGGGACTGCTTGGCAGCTGAGG + Intergenic
1159101767 18:63966140-63966162 CAGGGACTGAATCGCAGTGTGGG + Intronic
1159935472 18:74363471-74363493 CTGGGATTGGTGGGCAGCTTTGG - Intergenic
1160946107 19:1644806-1644828 CAGGGCCTGGTGGGGAGGGTGGG - Intronic
1161325551 19:3662040-3662062 CAGGGGGTGCAGGGCAGCGTGGG - Intronic
1161576595 19:5057982-5058004 GAGGGACTGATGGGCTGCTTAGG + Intronic
1162583841 19:11546992-11547014 CAGGGGGTGGTGGGCAGCCTGGG + Intronic
1163637408 19:18443722-18443744 CAGGGACCCATGGGCAGAGCTGG - Exonic
1164324309 19:24178647-24178669 CAGAAAGTGGTGGGCAGCGTTGG + Intergenic
1165074739 19:33274596-33274618 CAGGGAGGGATAGGCAGCCTTGG + Intergenic
1165433628 19:35785349-35785371 CATGGGCTGGTGGGCAGCGATGG + Intronic
1166282966 19:41807490-41807512 CAGGAAGTGATGGCCAGCCTGGG - Intronic
1166785356 19:45363951-45363973 AAGGGACTGGGGGGCAGCGGGGG + Intronic
1168405519 19:56108350-56108372 CAGGGAGTGCTGGGCAGGGGCGG - Intronic
1168641415 19:58034168-58034190 GAGGGACGGATGGGCCGCGGCGG - Intronic
1168669166 19:58228449-58228471 CAGGGACTCAGGGACAGCCTGGG - Intergenic
925099805 2:1235316-1235338 CAGGGACCTCAGGGCAGCGTGGG - Intronic
925099831 2:1235385-1235407 CAGGGACCTCAGGGCAGCGTGGG - Intronic
925099880 2:1235522-1235544 CAGGGACCTCAGGGCAGCGTGGG - Intronic
925099906 2:1235591-1235613 CAGGGACCTCAGGGCAGCGTGGG - Intronic
925764558 2:7218639-7218661 TGGGGACTGCTGGGAAGCGTGGG - Intergenic
925907291 2:8547078-8547100 CAGAGGCTGCTTGGCAGCGTGGG - Intergenic
928261085 2:29767438-29767460 CAGGGACTGATGGGTTTCCTGGG - Intronic
929812315 2:45200991-45201013 CAGGCTGTGATGGGCAGGGTGGG - Intergenic
932780604 2:74556331-74556353 CAGGGCCTGAGGGGCAGCGGCGG - Exonic
933701029 2:85255648-85255670 CAGGGACTGAAGGGCTGGGAAGG - Intronic
934487093 2:94725539-94725561 GAGGGTCTGAGTGGCAGCGTGGG - Intergenic
934650029 2:96085413-96085435 CTGGGACTGAGGGGCAGGGGTGG + Intergenic
935310251 2:101776263-101776285 CAGGGACTGATGGTCAGCTAAGG + Intronic
936255152 2:110904754-110904776 CAGGAAGAGATGGGCAGGGTTGG + Intronic
938233016 2:129678278-129678300 CAGACACTGCTGGGCAGTGTTGG + Intergenic
938815436 2:134899064-134899086 CTGGGAGTGATGGGCAGTGAAGG - Intronic
939391678 2:141576437-141576459 CAGGGCCTGTTGGGGAGCGGGGG + Intronic
1168859699 20:1037106-1037128 CAGGGACTCATGGCCAGCATTGG + Intergenic
1168954462 20:1825176-1825198 CAGGAGCTGTTGGGCAGTGTTGG - Intergenic
1169012618 20:2263208-2263230 CAAGGCCTGATGGGGAGCGGTGG - Intergenic
1170612988 20:17929374-17929396 CAGGGAGTGAGGGGCAGCGAGGG + Intergenic
1171486478 20:25489817-25489839 GAGGGCCTGCTGGGCAGAGTGGG - Intronic
1172148250 20:32772557-32772579 CAGAGAATGAGGGGCAGCATTGG - Intronic
1172481538 20:35274664-35274686 CAGGGTCTGAGGGGCAGCTCTGG + Exonic
1172607130 20:36221604-36221626 CAGGGTCTGAGAGGCAGCATTGG + Intronic
1173576959 20:44118471-44118493 CAGGGAAGGATGGGCAGGGTAGG - Intronic
1174112065 20:48204094-48204116 CATGGGCTGATGGGCAGCGCTGG - Intergenic
1174169098 20:48605149-48605171 CACGGGCTGACGGGCAGCGCTGG + Intergenic
1174862468 20:54103976-54103998 CAGGGAATGGTGGGTAGAGTAGG - Intergenic
1175382956 20:58576365-58576387 AAGGGAATCATGGCCAGCGTGGG + Intergenic
1176000823 20:62830514-62830536 CAGGGCCAGAAGGGCAGCATGGG + Exonic
1177894340 21:26843228-26843250 CAGAGGCTGCTGGGCAGAGTGGG - Intronic
1181031880 22:20152286-20152308 CAGGGACTCAGGGGCAGTGAGGG - Intergenic
1181413115 22:22738825-22738847 CAGGGAGTGATGGAGAGTGTGGG + Intronic
1181570632 22:23766246-23766268 CAGGGGCTGGGGGGCAGCGGGGG + Exonic
1183965058 22:41436590-41436612 CTGGGACTGAGGGGCCGGGTTGG + Exonic
953054189 3:39374625-39374647 CAGGGACTGATTGTCATTGTTGG + Intergenic
953211926 3:40883889-40883911 CTGGGACTGATGGGCACGGCTGG + Intergenic
953930928 3:47005330-47005352 CAGGGGCTGGTGGGCAGACTAGG + Intronic
957628726 3:82690134-82690156 AAGGGAATGATGAACAGCGTTGG - Intergenic
959609378 3:108277017-108277039 CAGGGACAGAGGTGCAGCCTAGG - Intergenic
961513562 3:127419308-127419330 CAGGGACTGAGGAGCAGGGCCGG + Intergenic
961634084 3:128321964-128321986 CAGTGAGTGAGGGCCAGCGTGGG + Intronic
962127067 3:132631673-132631695 GAAGGACTGATGGCCAGCGATGG - Intronic
962339257 3:134568270-134568292 CAGGGACTGGTGGGCTGTTTGGG - Intronic
962367773 3:134797178-134797200 CAGGGACTGCTGGGCTTTGTAGG + Intronic
962587846 3:136860781-136860803 TGGGGACTAATGGGCAGTGTTGG - Intergenic
964606517 3:158565928-158565950 CAGTGATGGATGGGCAGAGTGGG - Intergenic
968504867 4:967086-967108 CAGGGTCTGCTGGGCGGGGTGGG - Intronic
969541120 4:7789447-7789469 CAGGGGCTGGTGCGGAGCGTGGG - Intronic
969641653 4:8402291-8402313 CAGGAAGTGAAGGGCAGCGGGGG + Intronic
971299536 4:25430321-25430343 CAGGGCCTTCTGGGCAGTGTGGG + Intergenic
974525848 4:63049376-63049398 CAAGGACAGATGGGCAGTGGAGG - Intergenic
977312899 4:95409722-95409744 TAGGGAATGGTGGGCAGAGTGGG - Intronic
980131347 4:128819070-128819092 CAGGGAGTGATGGCCAAAGTGGG - Intronic
985362714 4:189192666-189192688 TGGGGCCTGATGGGCAGTGTTGG - Intergenic
986340854 5:6788168-6788190 CAGGGGCTGCAGGGCAGGGTGGG + Intergenic
986777314 5:11028529-11028551 CAGGGACTGAAGGGAAGGGTTGG - Intronic
988712665 5:33794021-33794043 CAGGGATTCATGGGGAGGGTGGG - Intronic
990968985 5:61482336-61482358 CGGGGCCTGTTGGGGAGCGTGGG + Intronic
992219300 5:74556079-74556101 CAGGGACTGTCTGGCAGGGTGGG - Intergenic
997347739 5:133204219-133204241 CAGAGAGTGCTGGGCAGCATTGG + Intronic
997884170 5:137615611-137615633 CAGGCACTAGTGGGCAGCTTTGG + Intergenic
998761357 5:145435445-145435467 AAGGGAGTGATGGGGAGAGTGGG + Intergenic
1001634079 5:173197301-173197323 CAGGGACTGCTGGGCTGGGCTGG + Intergenic
1001962790 5:175890331-175890353 CAGGAACTGGGGGCCAGCGTTGG - Intergenic
1002670935 5:180866561-180866583 CAGGGACAGCTGGGAAGCATTGG + Intergenic
1006037209 6:31223098-31223120 CAGGCACTGGTGGGAAGCTTGGG - Intergenic
1006929933 6:37681367-37681389 CAGGGACTTATGTCCAGCCTGGG - Intronic
1007987376 6:46220515-46220537 CAGGGCCTGGAGGGCAGGGTTGG - Intergenic
1012211990 6:96530908-96530930 CTGGTACTGATTGGCAGCCTGGG - Intronic
1013432726 6:110069525-110069547 CAGGGGCTGAGGAGCAGAGTTGG - Intergenic
1013783744 6:113756485-113756507 CAGTGACTCATGGACAGGGTTGG - Intergenic
1015268696 6:131316776-131316798 CAGAGACTGAGGGGCTGGGTTGG + Intergenic
1018035035 6:159874536-159874558 CAGAGGCAGATGGGCAGCCTAGG - Intergenic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1018454951 6:163943633-163943655 CAGGGTCTTTCGGGCAGCGTGGG + Intergenic
1018777101 6:167027663-167027685 CACTGATTGATGGGTAGCGTAGG + Intronic
1018988099 6:168653162-168653184 CAAGAACTGATGGGCTGCCTGGG + Exonic
1019193656 6:170268609-170268631 CAAGGACTGATGGTCACCGTGGG - Intergenic
1019813768 7:3184321-3184343 CAGGGGCTGAGGGGCAGGGCTGG + Intergenic
1022290813 7:29000845-29000867 CAGGGGCTGATGGGGAGAGGGGG - Intronic
1024799288 7:53057678-53057700 TAGGGTCTGATGGGGAGCCTGGG - Intergenic
1026324380 7:69296088-69296110 CAGGGACAGGGAGGCAGCGTTGG + Intergenic
1031325438 7:120391070-120391092 CAGGGCCTGTTGGGCAGTGGAGG - Intronic
1032011229 7:128349438-128349460 CAGGAGCTGATGGGCAAAGTTGG + Intergenic
1032608393 7:133384069-133384091 CAGGAACTGATGAGCAGCCAGGG + Intronic
1035583961 8:757924-757946 TAGTGACTGCTGGGCGGCGTGGG + Intergenic
1039050031 8:33484693-33484715 CAGGGTCTGAGGGGCAGGGCCGG + Intronic
1042103413 8:65298132-65298154 CAGGGACTGAAGGGGAGGGAAGG + Intergenic
1048161642 8:132026966-132026988 TAGGGAATGCTGGGCAGTGTAGG - Intronic
1048508212 8:135039872-135039894 CAGAAAATGATGGGCAGAGTTGG - Intergenic
1049373411 8:142278249-142278271 CTGGGACCCATGGGCAGAGTGGG - Intronic
1049635211 8:143684559-143684581 CAGGGACGGAGGGGCGGCGGGGG - Intronic
1049757781 8:144318426-144318448 CCGAGACAGATGGGCAGGGTGGG + Intronic
1049780572 8:144426845-144426867 CAGGGGCTGACGGGCAGTATTGG - Intronic
1052387206 9:27835980-27836002 GAGGGACTGATGAGCTGCTTGGG + Intergenic
1053309749 9:37010185-37010207 CAGGGACAGTTGGGCTGAGTTGG + Intronic
1056526400 9:87446872-87446894 CAGCAACTGAGGGGCAGGGTGGG - Intergenic
1056702832 9:88925083-88925105 CCATGACTGATGGTCAGCGTGGG + Intergenic
1057853982 9:98588622-98588644 CAGTGAGTGAGGGGCAGAGTTGG + Intronic
1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG + Exonic
1059999286 9:119943846-119943868 CAGGGACTGCAGGGCAGCTGTGG + Intergenic
1060424415 9:123492769-123492791 CAGGGAGTGAGAGGCAGCGCTGG + Intronic
1060665093 9:125428094-125428116 CAGAGACTGATGAGCAGAGCTGG + Intergenic
1061519601 9:131110316-131110338 CAGGACCAGATGGGCAGGGTGGG - Intronic
1061796445 9:133088256-133088278 CAGGCACTGTGGGGCAGGGTGGG + Intergenic
1062581857 9:137232344-137232366 GAGGGACGGATGGGCAGAGGTGG - Intronic
1062586343 9:137251590-137251612 CAGGGGCTGAGGGACAGTGTGGG + Intronic
1062729325 9:138100395-138100417 CAGGGACAGCTGGGGAGGGTGGG + Intronic
1186531233 X:10297905-10297927 CAGGGACTCATGGGGAAGGTAGG - Intergenic
1186568516 X:10690040-10690062 CAGGAAATGAGGGGCAGGGTGGG + Intronic
1189057284 X:37711406-37711428 CAGGTACTGATGAGAAGTGTGGG + Intronic
1189166955 X:38869970-38869992 CAGGGACTGATGGGTGTGGTAGG - Intergenic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1200141479 X:153904892-153904914 CCGGGACTCATGGGCTGCCTGGG + Intronic